ID: 971763362

View in Genome Browser
Species Human (GRCh38)
Location 4:30798089-30798111
Sequence GGCTCTAGTGGAGGACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971763355_971763362 12 Left 971763355 4:30798054-30798076 CCCATATGCGATAAATACACAGT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 114
971763354_971763362 29 Left 971763354 4:30798037-30798059 CCAAGATAAATGTGTTACCCATA 0: 1
1: 0
2: 0
3: 9
4: 199
Right 971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 114
971763356_971763362 11 Left 971763356 4:30798055-30798077 CCATATGCGATAAATACACAGTG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971763362 Original CRISPR GGCTCTAGTGGAGGACAAGT TGG Intronic
900875730 1:5341287-5341309 GGCTATAGTGGTGAACAAGCCGG - Intergenic
901217615 1:7563463-7563485 GGCTCTAGTGGGGCCCGAGTGGG - Intronic
906717393 1:47980259-47980281 AGCTGTATTGAAGGACAAGTGGG - Intronic
909482833 1:76143875-76143897 GGCTCTAGTGCAGGACTGCTGGG + Intronic
912449563 1:109760761-109760783 GGCTCCAATGGAGAACAAGCAGG - Intronic
912799679 1:112713028-112713050 GTCCCTGGTGGAGGAAAAGTTGG + Exonic
914680689 1:149936482-149936504 GGCTCTAGAGGAGGAGGAGGAGG - Intronic
917510072 1:175662463-175662485 GGCCCTAGGGGAGGCCCAGTAGG - Intronic
917965475 1:180176005-180176027 GGCTCCAGTGGGGGACAGGCTGG - Exonic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
920741707 1:208586983-208587005 GGCTCTGGTGGAAGACAGGATGG + Intergenic
921870752 1:220136894-220136916 GTCGTTAATGGAGGACAAGTAGG + Exonic
922058140 1:222061794-222061816 TCCACTAGTGGAGCACAAGTTGG + Intergenic
924199508 1:241644257-241644279 GGCTCCTGTGGAAGACAATTTGG + Intronic
924464932 1:244291217-244291239 GTCTCAAGTGGAGGAGAAGGAGG + Intergenic
1066302680 10:34110732-34110754 GTCTCTGGTGGAGGAAAAGTGGG - Exonic
1066648625 10:37635179-37635201 GGCACAAGTGGAGGACAGCTGGG + Intergenic
1068041727 10:51833853-51833875 GGCTGGAGTGGAGGAAAAGAAGG - Intronic
1069633732 10:69913076-69913098 GGCTCTAGGGGAGCACAAGTGGG - Intronic
1072536566 10:96368828-96368850 GGTTCTAGTGGAGCCAAAGTGGG + Intronic
1072881723 10:99234958-99234980 GGCTTGAGTGGTGGGCAAGTTGG - Intronic
1075319375 10:121477695-121477717 GGCTGAAGTGCAGGAGAAGTTGG + Intergenic
1076834537 10:133014485-133014507 GGCTCCACTGGAAGCCAAGTGGG - Intergenic
1077307461 11:1874525-1874547 GGCTCCAGGGGAGGCCAGGTGGG + Intronic
1081794394 11:45809624-45809646 GGCTGGAGTGGAGGACAGGGAGG + Intronic
1083934991 11:65865454-65865476 GGTGCTCGTGGAGGTCAAGTGGG + Intronic
1084758855 11:71255665-71255687 TGCTGTAGTGGAAAACAAGTAGG - Intergenic
1087093944 11:94302692-94302714 GGCTCTGAGGGAGGACAAGGAGG - Intergenic
1094673138 12:32590563-32590585 GGCTGTAGCAGAGCACAAGTTGG + Intronic
1096505828 12:52092357-52092379 GTCTCTGGGGGAGGAGAAGTGGG - Intergenic
1098440596 12:70513194-70513216 GGCTTTAGTGGAGGACTATGAGG - Intergenic
1104550640 12:129753913-129753935 GGCTCTAGTGGAGGAATAATAGG - Intronic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1112468750 13:99668908-99668930 GGCTCCAGGGCAGGACAAGCTGG + Intronic
1113229589 13:108197430-108197452 GGCTCTACTAGGGAACAAGTAGG + Intergenic
1113230776 13:108212811-108212833 TGCTCTAGTGGCAGACATGTAGG + Intronic
1116503688 14:45651839-45651861 GGCTCTAGTGATGGACATGGAGG - Intergenic
1117323211 14:54643907-54643929 GGCTCTAATGTAGGGCAGGTGGG + Intronic
1118618790 14:67595791-67595813 GGACCAGGTGGAGGACAAGTAGG + Intronic
1121124814 14:91399279-91399301 GGCTCTGGGTGAGGAGAAGTGGG - Intronic
1202929044 14_KI270725v1_random:22971-22993 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1123423316 15:20148525-20148547 GGCTCCAGGGGAGGCCAGGTGGG + Intergenic
1123532537 15:21155046-21155068 GGCTCCAGGGGAGGCCAGGTGGG + Intergenic
1123715059 15:23022123-23022145 TGCAATAGTGGTGGACAAGTTGG - Exonic
1123918580 15:25054962-25054984 TTCTCTAGTGGATGACAAGTTGG + Intergenic
1129251014 15:74308987-74309009 GGCTCCTGTGGAGGGCCAGTGGG + Intronic
1133319158 16:4902405-4902427 GGCACTGGTGGAGGAGAAGCTGG - Exonic
1133332270 16:4982123-4982145 GGCCCTGGTGGAGGACAGGCAGG + Intronic
1135623981 16:23979732-23979754 GGCTCTAGAGGAAGACAAACTGG + Intronic
1136861502 16:33707077-33707099 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1138658171 16:58502397-58502419 GGCTCTCCTGGAGGACAACAGGG + Intronic
1203123002 16_KI270728v1_random:1555268-1555290 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1150168040 17:62963816-62963838 GGCACTTTTGGAGGCCAAGTTGG + Intergenic
1152266859 17:79300149-79300171 AGCACTTTTGGAGGACAAGTTGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1157126141 18:44957975-44957997 GGCTGTTGTGGAGTTCAAGTAGG + Intronic
1160853265 19:1205054-1205076 GGCGCTAGTGCAGGAAAAGGTGG + Intronic
1163950327 19:20578319-20578341 GGCACTATGGGAGGCCAAGTTGG - Intronic
1165105516 19:33467585-33467607 GGCTCAAATGTAGGACAAGAAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167693579 19:51001662-51001684 GGCTCTAGTGCAGGAGGAGAAGG - Intronic
1202693345 1_KI270712v1_random:106005-106027 GGCTCCAGGGGAGGCCAGGTGGG + Intergenic
925150578 2:1612114-1612136 GCCTTTAGAGGAGGAGAAGTGGG - Intergenic
926323685 2:11766309-11766331 GGCTCAAGGGGAGGAGAAATAGG + Intronic
927078137 2:19600872-19600894 GGCTCTCTTGGAGGATAACTGGG - Intergenic
928983117 2:37156564-37156586 GGGTCTAGTGGAAGACGAATAGG - Intronic
933953223 2:87348554-87348576 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
934237454 2:90244899-90244921 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
938908359 2:135860868-135860890 GGCTCTAATCAAGGACAATTAGG + Intronic
940082833 2:149823924-149823946 GGCAATAATGGAGGACAAGAAGG + Intergenic
942333607 2:174855569-174855591 GGCTCTAATGGAGAAAAAATAGG - Intronic
944942244 2:204641383-204641405 GGCTCCCGTGAAGGACTAGTGGG + Intronic
947793587 2:232880919-232880941 GGCTCTAGGGGAGGACAGGGAGG + Intronic
948240593 2:236429774-236429796 GGCTCCAGTGGGGGACAGGTAGG + Intronic
1170312601 20:15008913-15008935 GGGTTTAGTGGAGGAGGAGTTGG + Intronic
1171160572 20:22918914-22918936 GGCTGTAGTGATGGAGAAGTAGG - Intergenic
1176591063 21:8651559-8651581 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1178620705 21:34171937-34171959 GGTTCTAGTTCAGGGCAAGTTGG + Intergenic
1178977381 21:37231569-37231591 GGATCAAGTGAAGGACAAGCTGG - Intronic
1180273891 22:10628592-10628614 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1180946073 22:19694282-19694304 GGATCCAATGCAGGACAAGTAGG + Intergenic
1181356325 22:22298294-22298316 GGCTCCAGGGGAGGCCAGGTGGG + Intergenic
952866120 3:37856275-37856297 GGCTGTATTTGAGGAGAAGTAGG - Intergenic
957719488 3:83975151-83975173 GGCTTTAGTGCAGGACTAATAGG + Intergenic
959526523 3:107383676-107383698 GGCCCTAGTGGAGGACACCATGG + Intergenic
962623984 3:137207119-137207141 GGCTGTTTTGCAGGACAAGTAGG - Intergenic
967203328 3:187095141-187095163 GTCTGCAGTGGTGGACAAGTGGG - Intergenic
968311138 3:197683945-197683967 GGCTCTCGTGGAGGCAAAGCTGG - Intronic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
972543479 4:40058442-40058464 GGCTGTAGTGGTGGACATGGTGG + Intronic
977237093 4:94521324-94521346 AACTCTAGTGGAAGGCAAGTAGG + Intronic
981081631 4:140643651-140643673 GACGCTAGTGGAGGCCAAGGAGG - Intronic
991337723 5:65567928-65567950 GGCACTAGTGGAGAAAATGTGGG + Intronic
996430588 5:123371754-123371776 GGCACTAGCGGAAGACCAGTGGG - Intronic
996867900 5:128149379-128149401 GCCACTTGTGGAGAACAAGTGGG + Intronic
997214926 5:132102531-132102553 GTCCCTTGTGGAAGACAAGTAGG - Intergenic
1000543105 5:162565877-162565899 GGCAAGAGTGGAGGACTAGTGGG - Intergenic
1001666131 5:173435137-173435159 GGCTCTACTGTAGGGCATGTGGG - Intergenic
1002970891 6:2018053-2018075 GGTTTTTGTGGATGACAAGTAGG - Intronic
1004154838 6:13158382-13158404 GGCTATATGGGAGGACAAGGGGG - Intronic
1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG + Intronic
1018611290 6:165650062-165650084 GGATCTTGTGTAGGAGAAGTGGG + Intronic
1024057803 7:45676551-45676573 GGCTGTCATGGAGGATAAGTGGG - Intronic
1025603822 7:63024522-63024544 GGTTATAGTGGAGGAAAAGCTGG - Intergenic
1031919652 7:127591392-127591414 GGCTATGGGGGAGGAAAAGTGGG - Exonic
1033512268 7:142070668-142070690 TGCTCTAGTTGAGAACATGTAGG + Intronic
1033515297 7:142099287-142099309 TGCTCTAGTTGAGAACATGTAGG + Intronic
1038436574 8:27540738-27540760 GGCTGTGGTGGAGGAGAACTGGG - Intronic
1041696653 8:60742966-60742988 GGCTGCAGTGGAGGACAGGTTGG - Exonic
1042183828 8:66117701-66117723 GGGTCGGGTGGAGGAGAAGTGGG + Intergenic
1047169953 8:122483162-122483184 GGCTCTAGGGGAGGAGATGGTGG - Intergenic
1047403195 8:124562988-124563010 GGCTGCTGTGGAGGACAAGCAGG + Exonic
1049420507 8:142514307-142514329 AGCTCTAGAGGAGGACTCGTGGG - Intronic
1049844284 8:144792522-144792544 GGCCCTGGAGGAGGAGAAGTAGG - Exonic
1052865825 9:33464147-33464169 GTCTCTAGTGGAGGAGCAGGTGG - Exonic
1053690383 9:40584013-40584035 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1054301634 9:63384974-63384996 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1056444440 9:86652215-86652237 GGTTTTAATGCAGGACAAGTGGG + Intergenic
1056622816 9:88228509-88228531 GGCTCTAGTGGTGGTTATGTTGG - Intergenic
1060172705 9:121474888-121474910 GGCTCAAGCGGAGGACGGGTGGG - Intergenic
1061446363 9:130640432-130640454 GGCCCTAGTGGACCAGAAGTGGG - Intergenic
1062170742 9:135133386-135133408 GGCTCGGGTGGGGGACAAGCTGG + Intergenic
1203621080 Un_KI270749v1:130282-130304 GGCTCCAGGGGAGGCCAGGTGGG - Intergenic
1186318985 X:8403662-8403684 AGCTGTAGTGGAGGCCAAGAAGG - Intergenic
1200158214 X:153989540-153989562 GGCCCCAGTGGAGGTCAAGTGGG - Intergenic