ID: 971764684

View in Genome Browser
Species Human (GRCh38)
Location 4:30815274-30815296
Sequence GAGGAAATAATTAGGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 11, 3: 91, 4: 523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971764677_971764684 15 Left 971764677 4:30815236-30815258 CCATATGGGTCTGCAACAACTGG 0: 1
1: 0
2: 8
3: 30
4: 206
Right 971764684 4:30815274-30815296 GAGGAAATAATTAGGCTGAGGGG 0: 1
1: 0
2: 11
3: 91
4: 523
971764676_971764684 19 Left 971764676 4:30815232-30815254 CCATCCATATGGGTCTGCAACAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 971764684 4:30815274-30815296 GAGGAAATAATTAGGCTGAGGGG 0: 1
1: 0
2: 11
3: 91
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971764684 Original CRISPR GAGGAAATAATTAGGCTGAG GGG Intronic
900232391 1:1566905-1566927 GAGGAAAAACTCAGGCAGAGGGG + Intronic
900753038 1:4411748-4411770 GAAGAAAGAATTCGACTGAGGGG + Intergenic
900835532 1:5000554-5000576 GAGGAAAGAAATAGGCGGGGCGG - Intergenic
902032917 1:13435963-13435985 GAGGAAATCAACAGGGTGAGTGG - Intergenic
902120718 1:14163145-14163167 GAGGAAAGAATTTATCTGAGGGG + Intergenic
903710149 1:25317278-25317300 GAGGTTATAAGTAGGGTGAGTGG + Intronic
903716967 1:25375128-25375150 GAGGTTATAAGTAGGGTGAGTGG - Intronic
905209956 1:36367220-36367242 GAGGCAACAATGAGGGTGAGGGG + Intronic
906680128 1:47720549-47720571 AAGGAAATAAAGAGGTTGAGGGG - Intergenic
906818119 1:48900009-48900031 GAGGAAACATTTGAGCTGAGGGG + Intronic
907079422 1:51607761-51607783 GAGGAAAGAATTTGGCCAAGGGG + Intronic
907232804 1:53015811-53015833 GAGGTAAAAATTAGACTGTGAGG - Intronic
907253091 1:53156276-53156298 GAGGAAAGAATTTGACCGAGGGG - Intergenic
909099780 1:71336196-71336218 GAAGAAAGAATTTGACTGAGGGG + Intergenic
909105596 1:71402924-71402946 GAAGAAATAATGAAGCTGTGGGG + Exonic
909546679 1:76855883-76855905 AAGGAAATAAGTAGGCAGGGTGG + Intergenic
909755843 1:79224319-79224341 GAGGAAATATATAGGATGAGAGG + Intergenic
910101715 1:83584241-83584263 GGGGAAATAATTAGGTTTAGAGG - Intergenic
910461599 1:87453598-87453620 AAAGAAATAATTTGACTGAGGGG + Intergenic
910631064 1:89354813-89354835 GAAGAAAGAATTTGACTGAGGGG - Intergenic
911159285 1:94668275-94668297 GAGGAAAGAATTCGTCTGAGGGG - Intergenic
911551374 1:99285627-99285649 TAGGAAATAATTAGGTTTACCGG - Intronic
911746507 1:101447186-101447208 GAGGAAAGAATTCAGCTGAGGGG - Intergenic
911854470 1:102859374-102859396 GAAAAAATAATTTGACTGAGGGG - Intergenic
911948466 1:104140244-104140266 GAAGAAAGAATTTGACTGAGGGG - Intergenic
912237338 1:107866262-107866284 GAAGAAAGAATTCGACTGAGGGG - Intronic
913422666 1:118689611-118689633 GAAGAAAGAATTAGACTGAGGGG + Intergenic
914318819 1:146539891-146539913 GAAGAAAGAATTTGACTGAGGGG + Intergenic
914495539 1:148193466-148193488 GAAGAAAGAATTTGACTGAGGGG - Intergenic
916317244 1:163463152-163463174 GATGAAATATTTAGGGTGAAGGG - Intergenic
916706512 1:167356624-167356646 GAAGAAAGAATTCGACTGAGGGG + Intronic
916784581 1:168076780-168076802 GAGCACATGAATAGGCTGAGGGG - Intergenic
917314478 1:173710293-173710315 GAAGAAAGAATTTGACTGAGGGG + Intergenic
917567365 1:176226534-176226556 GAGGAAAGAATTAGACTGCGGGG - Intergenic
918077587 1:181182249-181182271 GAGGAAAGAATTCGGCTGCGGGG - Intergenic
918453907 1:184687566-184687588 GAAGAAAAAATTATGGTGAGGGG - Intergenic
918454183 1:184689978-184690000 GAAGAAAAAATTATGGTGAGGGG - Intergenic
918484221 1:185012215-185012237 GAAAAAATATTTAGGGTGAGTGG - Intergenic
918882559 1:190144184-190144206 GAGGAAATAAAAAGGGGGAGGGG - Intronic
918984591 1:191607985-191608007 GAAGAAAGAATTTGACTGAGGGG + Intergenic
919230450 1:194766036-194766058 GAAGAAATATGTAGGCTGGGAGG + Intergenic
919298523 1:195732813-195732835 GAAGAAAGAATTCGACTGAGGGG - Intergenic
920798056 1:209159804-209159826 GGGGAAAGAATTCAGCTGAGCGG + Intergenic
920879103 1:209863790-209863812 GAAGAAAGAATTCAGCTGAGGGG + Intergenic
921387820 1:214588605-214588627 GGGCAAATAATTTGGCTGATAGG - Intergenic
921519235 1:216139129-216139151 GAGGAAATACTGAAGCTGAGAGG - Intronic
921808980 1:219489928-219489950 AAGCAAATAAGTAGGCTAAGAGG - Intergenic
922155294 1:223036328-223036350 GAGGAAGTCAAGAGGCTGAGAGG + Intergenic
922333706 1:224600996-224601018 GAAGAGATAATTTGACTGAGAGG + Intronic
922875397 1:228936432-228936454 GAAGAAAAAATTCGACTGAGGGG - Intergenic
923009534 1:230077170-230077192 GAGGAAACAATGAGACTGGGAGG - Intronic
923511949 1:234660539-234660561 GAAGAAAGAATTCGACTGAGGGG - Intergenic
923965557 1:239134809-239134831 GAAGAAAGAATTTGACTGAGGGG - Intergenic
924092191 1:240513130-240513152 TAGGACATAATTAGGTTGAATGG + Intronic
924171732 1:241349443-241349465 TAGAAAATATTTTGGCTGAGTGG - Intronic
924298274 1:242611161-242611183 GAAGAAAGAATTTGACTGAGGGG + Intergenic
924710610 1:246527553-246527575 GAGGAAGTGGTTATGCTGAGGGG + Intergenic
1062947609 10:1473263-1473285 GAAGAAAGAATTCGCCTGAGGGG - Intronic
1062986867 10:1777053-1777075 GAGGAAAGAATTCAGCTGAGGGG - Intergenic
1063521160 10:6742596-6742618 GAAGAAAGAATTTGTCTGAGGGG + Intergenic
1064513766 10:16124059-16124081 GAAGAAAGATGTAGGCTGAGAGG - Intergenic
1065309268 10:24398467-24398489 GAAGAAACAATTTGACTGAGGGG + Intronic
1065534838 10:26706859-26706881 GAAGAAAGAATTCGACTGAGGGG + Intronic
1066289261 10:33998934-33998956 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1066398789 10:35053747-35053769 AAGGAAATAAACAGGCTAAGAGG - Intronic
1067954908 10:50780397-50780419 GAAGAAAGAATTTGACTGAGGGG + Intronic
1068142293 10:53023986-53024008 GAGGAAAGAATTTGGCCAAGGGG - Intergenic
1068497104 10:57796401-57796423 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1068717969 10:60209328-60209350 GAGCAAATAACTTGGCTCAGAGG - Intronic
1068758320 10:60680229-60680251 GAGGAAGTAATTCAACTGAGGGG - Intronic
1068835124 10:61544800-61544822 GAGGAAATAATCAAAGTGAGGGG + Intergenic
1069071092 10:63991211-63991233 GAGGAAAGAATTTGGCTGAGGGG - Intergenic
1069174317 10:65271328-65271350 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1069205071 10:65671527-65671549 TAGGAAAAAATTAGTCTGTGCGG + Intergenic
1069735978 10:70654573-70654595 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1071960237 10:90803094-90803116 GAAGAAAGAATTTGTCTGAGGGG + Intronic
1073335151 10:102701788-102701810 GAGGAAATAATAATGATGAATGG + Intronic
1073404581 10:103285973-103285995 GAGGAAATAACAAGCCTGAAGGG + Intronic
1073888764 10:108072390-108072412 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1074002691 10:109388362-109388384 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1074033576 10:109714391-109714413 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1074286613 10:112103835-112103857 GAAGAAAGAATTAGACTGAGGGG + Intergenic
1074839731 10:117338465-117338487 GAGTACATAATTAGGCTGAAGGG - Intronic
1075618985 10:123911891-123911913 GAAGAAAGAATTCGACTGAGGGG + Intronic
1077839180 11:5955427-5955449 GAAGAAAGAATTCAGCTGAGGGG + Intergenic
1077960526 11:7072383-7072405 GAGGAAAGAATTCAACTGAGAGG + Intergenic
1078273582 11:9820820-9820842 AAGGAAAAAATTAGGCTGAAAGG + Intronic
1078281264 11:9903510-9903532 GAAGAAAGAATTGGACTGAGGGG + Intronic
1079624870 11:22604899-22604921 GAAGATAAAATTAAGCTGAGAGG + Intergenic
1080809197 11:35686069-35686091 GAGGAAAAAAGTATTCTGAGTGG - Intronic
1081088859 11:38836143-38836165 AAGGGAATAATTAGGCCCAGTGG + Intergenic
1081159020 11:39731293-39731315 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1081253961 11:40869925-40869947 GAAGAAAGAATTAGACTGAGGGG - Intronic
1081305014 11:41501430-41501452 GAAGAAAGAATTTGGCTGAGGGG + Intergenic
1081434320 11:43010529-43010551 GAGGAAAGAATTCGGCTAAGGGG + Intergenic
1081628022 11:44666955-44666977 GCAGAAATAACGAGGCTGAGAGG + Intergenic
1082852283 11:57776051-57776073 GAGAACATAATTGGGCAGAGGGG + Intronic
1085622006 11:78044667-78044689 GAGGAAAGAATTAGTCGGAGGGG + Intronic
1085928503 11:81052935-81052957 GAGGGAATTATAAGGGTGAGAGG - Intergenic
1086390219 11:86356004-86356026 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1086511657 11:87565065-87565087 TAGGAATTAAGTAGGCAGAGGGG - Intergenic
1086533155 11:87810886-87810908 GAAGAAAGAATTCAGCTGAGGGG + Intergenic
1087438859 11:98157833-98157855 GAAGAAATGATTATACTGAGGGG + Intergenic
1087525688 11:99308821-99308843 GAGGAAAAAATAAGAATGAGAGG - Intronic
1088716792 11:112555756-112555778 GAGGAGAACATTAAGCTGAGAGG - Intergenic
1088934308 11:114383663-114383685 GAGGAGGTAATTAGCCTGATGGG - Intergenic
1090166918 11:124559316-124559338 GAGAAAGTATTTAGGATGAGAGG - Intergenic
1090980235 11:131713758-131713780 GAAGAAAGACTTAGACTGAGGGG + Intronic
1091757941 12:3067515-3067537 GAAGAAACAATTCGACTGAGGGG - Intergenic
1092078120 12:5690286-5690308 GAGAAAATATTGAGGCTCAGAGG - Intronic
1094062663 12:26331526-26331548 GAAGAAATAATTCAACTGAGGGG - Intergenic
1094615236 12:32030337-32030359 AAAGAAATAAATAGGCCGAGTGG + Intergenic
1095211545 12:39500586-39500608 GAAGAAAGAATTAGACTGAGGGG + Intergenic
1095314747 12:40746417-40746439 GAAGAAAGAATTTGACTGAGGGG + Intronic
1095484499 12:42671317-42671339 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1097134146 12:56837334-56837356 GAGGAAAGAATTTGACTGAGGGG + Intergenic
1097451468 12:59741891-59741913 GAAGAAATAATTTGACTGAGGGG + Intronic
1097939954 12:65293408-65293430 GAGAAAATGATAAGGCTGACAGG - Intronic
1098226897 12:68333365-68333387 GAGGAAATATTCAGACTGAAAGG + Intergenic
1098647341 12:72919944-72919966 GAAGAAATAAGTCGACTGAGGGG + Intergenic
1098720765 12:73894775-73894797 AAGCAAATATTGAGGCTGAGAGG - Intergenic
1099193019 12:79580386-79580408 GATGAAAAAATTATGCTGATAGG - Intronic
1100135790 12:91551958-91551980 GAAGAAATAATTTGACTGAGGGG + Intergenic
1100135957 12:91553579-91553601 GAGGAAAGAATTCGGCTGAGGGG - Intergenic
1100569968 12:95838092-95838114 GAAGAAACAATTTGACTGAGGGG + Intergenic
1100636399 12:96438643-96438665 GACGGAATAACTAGGCAGAGAGG - Intergenic
1100758409 12:97777683-97777705 GAGGAAATAATTTGTCTCAGGGG - Intergenic
1100774436 12:97958909-97958931 GAGAAAATAGTGATGCTGAGAGG + Intergenic
1103126717 12:118429667-118429689 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1103554758 12:121759315-121759337 GAAGAAAGAATTTGACTGAGGGG + Intronic
1104250443 12:127088573-127088595 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1104683431 12:130768205-130768227 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1105696433 13:22893631-22893653 GAAGAAAGAATTCAGCTGAGGGG - Intergenic
1105877096 13:24566480-24566502 GAGAAAATAATTGGGCCCAGTGG + Intergenic
1106172456 13:27299656-27299678 TAGTAAATATTTAGGCTTAGGGG + Intergenic
1106258321 13:28041698-28041720 GACTAACTAATTAGGCTGATTGG + Intronic
1106693409 13:32144913-32144935 GAGGAAATAATTAGTTTTAACGG + Intronic
1107763560 13:43708526-43708548 GAAGAAAGAATTTGACTGAGGGG - Intronic
1107799740 13:44094597-44094619 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1108107536 13:47027909-47027931 GAGGAAATGTTTAGGCTGTTTGG + Intergenic
1108483048 13:50894763-50894785 GAAGAAAGAATTTGGCTCAGGGG - Intergenic
1108702139 13:52952809-52952831 GAAGAAAGAATTCGACTGAGAGG + Intergenic
1108718385 13:53105009-53105031 GAAGAAAGAATTCAGCTGAGGGG + Intergenic
1110004734 13:70251603-70251625 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1110026949 13:70552526-70552548 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1110505919 13:76285761-76285783 GAGGAAAGAATTCAGCAGAGAGG - Intergenic
1110937361 13:81307652-81307674 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1111151158 13:84254863-84254885 GAAGAAAGAATTTGACTGAGCGG - Intergenic
1111553290 13:89845753-89845775 GAAGAAATAATTGGGAAGAGTGG - Intergenic
1111798873 13:92958273-92958295 GAAGAAACAATTTGACTGAGGGG - Intergenic
1112019219 13:95357267-95357289 GAGGAAAGAATTCATCTGAGGGG - Intergenic
1112020516 13:95367249-95367271 GAAGAAAGAATTTGACTGAGAGG + Intergenic
1112390829 13:98982454-98982476 GAGGTAAAAAGTAGGCTCAGAGG - Intronic
1112638818 13:101248231-101248253 GAGAAAATAATAAAGGTGAGAGG + Intronic
1113864679 13:113513142-113513164 CAGCAAATAATTGGGCTGATAGG + Intronic
1114312722 14:21482207-21482229 GGGGAAATAATTAGGCATAAAGG + Intronic
1114426698 14:22629746-22629768 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1114438876 14:22730291-22730313 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1114457918 14:22868865-22868887 AAATAAATAAATAGGCTGAGTGG + Intergenic
1114565368 14:23627990-23628012 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1114881877 14:26796350-26796372 GAAGAAAGAATTCGACTGAGTGG - Intergenic
1115887957 14:37994640-37994662 GAAGAAAGAATTTGACTGAGGGG - Intronic
1116173322 14:41430646-41430668 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1116276414 14:42839284-42839306 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1116341261 14:43726171-43726193 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1116566176 14:46446949-46446971 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1117099712 14:52333867-52333889 GAGGAAAGAATTCGGCTGAGGGG + Intergenic
1117307745 14:54493063-54493085 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1117879118 14:60291629-60291651 GAGGACATAATCATGGTGAGTGG + Intronic
1119298444 14:73552167-73552189 GAAGAAAGAATTTGACTGAGGGG - Intronic
1119302741 14:73584354-73584376 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1119403946 14:74384100-74384122 GATGAAATATTTAGGGAGAGTGG + Intergenic
1119596975 14:75944127-75944149 GAAGAAAGAATTTGACTGAGGGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120360622 14:83497088-83497110 GAGGAATGTATTAGGCTGATTGG + Intergenic
1120430005 14:84401656-84401678 GAGAAAATAATTCGACTGAGGGG - Intergenic
1120477590 14:85008037-85008059 GAAGAAATAATTTCACTGAGGGG + Intergenic
1120584859 14:86299797-86299819 GAAGAAAAAATTTGGCTGAGGGG + Intergenic
1120970001 14:90199283-90199305 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1121004277 14:90478445-90478467 GAGGAAAGAATTTGACTGAGGGG + Intergenic
1122144653 14:99682496-99682518 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1122330322 14:100907692-100907714 AAGGAAATAAACAGGTTGAGGGG - Intergenic
1123126181 14:105947647-105947669 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
1123406690 15:20023701-20023723 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
1123431010 15:20216344-20216366 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1123516020 15:21030349-21030371 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
1123580012 15:21706435-21706457 TAAGAAATGATTAGGCCGAGAGG + Intergenic
1123616660 15:22149057-22149079 TAAGAAATGATTAGGCCGAGAGG + Intergenic
1123684886 15:22789733-22789755 GAAGAAAGAATTTGGCTGAGGGG + Intronic
1123778303 15:23601944-23601966 GAAGAAAGAATTCGACTGAGGGG + Intronic
1123825088 15:24073211-24073233 GAGGAAATAATTTGTCCTAGGGG + Intergenic
1124078635 15:26470491-26470513 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1124159285 15:27254239-27254261 GAGGAAAGAACCAGGCTGCGAGG + Intronic
1124400748 15:29345542-29345564 GAGGAAACAATTAGGGGGAATGG + Intronic
1124487146 15:30128617-30128639 AAGGAAACAATTAGACTTAGTGG - Intergenic
1124542233 15:30597592-30597614 AAGGAAACAATTAGACTTAGTGG - Intergenic
1124548938 15:30659697-30659719 AAGGAAAAAATTAGACTTAGTGG - Intronic
1124756379 15:32409706-32409728 AAGGAAAAAATTAGACTTAGTGG + Intergenic
1125115534 15:36086836-36086858 GAGGAAAGAATTCCACTGAGGGG - Intergenic
1125897263 15:43313039-43313061 GAGGAAGAAGTTAGGCTGTGAGG + Intergenic
1126580533 15:50238592-50238614 GAGGAAACCATCAGGCTGGGAGG - Intergenic
1127349353 15:58134968-58134990 GAGGTAATAATTAGGTGGAAAGG + Intronic
1128343603 15:66839942-66839964 GAAGAAAGAATGAGGCTGCGTGG - Intergenic
1128822391 15:70670568-70670590 GAGGAAAGGATTCGGCTGAGGGG - Intronic
1128849834 15:70943299-70943321 GAAGAAAGAATTTGACTGAGGGG + Intronic
1130153701 15:81332119-81332141 GAAGAAAGAATTTGGCAGAGGGG - Exonic
1131231532 15:90663522-90663544 GCGGAAATAAATAGGCTTACAGG + Intergenic
1202988882 15_KI270727v1_random:440680-440702 TAAGAAATGATTAGGCCGAGAGG + Intergenic
1133979009 16:10619753-10619775 GAGGAGATAACGAGGCTGGGTGG - Intergenic
1135177556 16:20244115-20244137 GAGGAAGCAGTTAGGATGAGAGG + Intergenic
1135431451 16:22387291-22387313 GAGGACATATTTAGGTTAAGGGG - Intronic
1136853643 16:33634903-33634925 GAAGAAATAATTTGACTGAGGGG + Intergenic
1137386926 16:48050404-48050426 GAGGAAAGAATTTGTCTGAGGGG - Intergenic
1138695847 16:58812833-58812855 GATGAAGAAATTAGGCTTAGAGG + Intergenic
1138748281 16:59389168-59389190 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1138947015 16:61863976-61863998 GGGGAATTAATAAGGATGAGAGG - Intronic
1139919697 16:70451616-70451638 TACAAAATAATGAGGCTGAGAGG - Intergenic
1140128058 16:72134223-72134245 GAAGAAAGAATTTGACTGAGGGG - Intronic
1142391497 16:89803909-89803931 GAGAAAAAAATTGGGCTGGGTGG - Intronic
1203115234 16_KI270728v1_random:1483348-1483370 GAAGAAATAATTTGACTGAGGGG + Intergenic
1142680092 17:1542414-1542436 GAGGCAATAATTAGCTTGAAGGG - Intronic
1144300590 17:13919899-13919921 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1144452528 17:15392873-15392895 AATGAAAAAATTAGGCTTAGAGG - Intergenic
1146823344 17:36001991-36002013 GAAGAAATAATTCAACTGAGGGG + Exonic
1147001824 17:37368775-37368797 GATGCAATAATAAGCCTGAGTGG - Intronic
1147563801 17:41524521-41524543 CAGGAAATCAGTACGCTGAGGGG - Exonic
1148259940 17:46172853-46172875 GAGTAAATTCCTAGGCTGAGAGG - Intronic
1148904578 17:50904217-50904239 CTTGAAATCATTAGGCTGAGGGG + Intergenic
1148956817 17:51361040-51361062 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1149074698 17:52581214-52581236 GAGGAAATAATGAGCTTAAGTGG - Intergenic
1149290841 17:55216228-55216250 GAGGAAGGAATTTGGCTGAGGGG - Intergenic
1149799561 17:59554762-59554784 GAACAAATAATTCGACTGAGGGG + Intergenic
1150602562 17:66663458-66663480 GAGGAAATAATCAGACCGAGGGG + Intronic
1150827890 17:68492720-68492742 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1153095021 18:1390826-1390848 GAGGAAATAAGTAGTGTGAATGG - Intergenic
1155668965 18:28346368-28346390 GAGGAAATGAATAGGCTAAAAGG - Intergenic
1156249915 18:35343474-35343496 GAATAAATAAATAGGCTGAATGG - Intronic
1156388957 18:36632813-36632835 AAGGAAAGAATTTGTCTGAGGGG + Intronic
1156644294 18:39141151-39141173 GAAGAAATAATTTGACTGACGGG - Intergenic
1157409683 18:47453401-47453423 GAAGAAATAATTTGACTGCGGGG - Intergenic
1157915031 18:51656058-51656080 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1158094646 18:53756784-53756806 GTGGAAAGAATTTGGCTAAGGGG - Intergenic
1158816157 18:61099583-61099605 GAGGGAATAAAAAGTCTGAGAGG + Intergenic
1159054628 18:63451584-63451606 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1159245238 18:65797254-65797276 AAGTCAATAATTAGGCTGATGGG - Intronic
1159324958 18:66902765-66902787 GAAGAAAAAATTTGACTGAGGGG - Intergenic
1159891311 18:73955672-73955694 GAAGAAAGAATTTGACTGAGCGG - Intergenic
1160600570 18:80009549-80009571 GAGGAAAGAATTTGGCTGAGAGG + Intronic
1162866943 19:13555128-13555150 TAAGAAATAATTTGTCTGAGGGG + Intronic
1165483768 19:36082917-36082939 AAGGAAATAATTATTCTGATTGG + Intronic
1167302063 19:48683785-48683807 GAAGAAAGAATTCGACTGAGGGG - Intergenic
925083572 2:1090442-1090464 GAGGAAAGAACTGGGTTGAGGGG + Intronic
925552795 2:5094237-5094259 GAAGAAAAAATTTGACTGAGGGG - Intergenic
927351531 2:22123014-22123036 GAAGAAAGAATTTGACTGAGGGG - Intergenic
927625326 2:24710787-24710809 GAAGAAATAATTAGAATGATTGG - Intronic
928164223 2:28957948-28957970 GAGCAACTAATTAGGATGTGAGG + Intronic
928299358 2:30111796-30111818 GAAGAAAGAATTTGGCTGAGGGG + Intergenic
929178636 2:39008579-39008601 TAGGAAATAAGACGGCTGAGAGG + Intronic
930591051 2:53326764-53326786 GAAGAAAGAATTTGACTGAGGGG - Intergenic
930599931 2:53431383-53431405 GAGAAAATAAATAGGCTCAGAGG - Intergenic
930898705 2:56477129-56477151 GAAGAAAGAATTATGCTGAGGGG - Intergenic
931114434 2:59149061-59149083 GAAGAAAGAATTCAGCTGAGGGG - Intergenic
932486954 2:72090046-72090068 GAAGAAAGAATTCGACTGAGGGG - Intergenic
932557594 2:72838950-72838972 GAGGAAATAATAAAGATCAGAGG - Intergenic
932870222 2:75390936-75390958 GAAGAAACAATTTGACTGAGGGG + Intergenic
932897429 2:75655011-75655033 AAAGCAATAATTAGGCTGATAGG - Intronic
933064817 2:77779937-77779959 GAAGAAAGAATTCGACTGAGGGG + Intergenic
933069191 2:77836346-77836368 AAGGAAAGAATTTGGCTGAGGGG - Intergenic
933368534 2:81386653-81386675 GAAGAAAGAATTCGACTGAGGGG - Intergenic
934039622 2:88116980-88117002 GAGGAAAGCATTCGTCTGAGGGG + Intergenic
935182488 2:100703353-100703375 GAGGCAATAAATACGCAGAGAGG - Intergenic
935261375 2:101358704-101358726 GAAGAAAGAATTCAGCTGAGGGG + Intronic
935299964 2:101685605-101685627 GAAGAAAGAATTTGACTGAGCGG + Intergenic
936157695 2:110059314-110059336 GAAGAAAGAATTTGACTGAGGGG + Intergenic
936186997 2:110312130-110312152 GAAGAAAGAATTTGACTGAGGGG - Intergenic
936840613 2:116764074-116764096 GAAGAAAGAATTCGACTGAGGGG + Intergenic
936963650 2:118104008-118104030 GAGGAAATAAAGAGGATGATAGG - Intronic
937714614 2:125017183-125017205 GAAGAAATAATTCGACTGAGGGG - Intergenic
937923302 2:127147327-127147349 CAGGAACTAAGCAGGCTGAGGGG - Intergenic
938255608 2:129857927-129857949 GAGGAAATTAATAGGCAGTGTGG + Intergenic
939080942 2:137661565-137661587 GAGGAAATAATTCATCTGAGGGG + Intronic
939195014 2:138961139-138961161 GAAGAAAGAATTCGACTGAGGGG + Intergenic
939260708 2:139805363-139805385 CAGGAAATATTTGGGCAGAGGGG - Intergenic
939497595 2:142942600-142942622 GAAGAAATAATTCAACTGAGGGG + Intronic
939712052 2:145534278-145534300 AAGGAAATATTTAGGGTTAGTGG + Intergenic
939865129 2:147464184-147464206 GATGAAAAAATTAAGCTGAGAGG + Intergenic
940117530 2:150225469-150225491 GAAGAAAGAATTTGACTGAGAGG + Intergenic
940782985 2:157952931-157952953 GAGGAAAAAATTTGGCTAAGGGG - Intronic
941245722 2:163094061-163094083 GAGAAAATAAAAAGACTGAGAGG - Intergenic
941421433 2:165287015-165287037 GAGGAAAGAATTTGGCTGAGGGG + Intronic
941991649 2:171562858-171562880 TAGGAAATTTCTAGGCTGAGTGG + Intergenic
942110012 2:172672974-172672996 GAAGAAATAATTCAACTGAGGGG + Intergenic
942619565 2:177833076-177833098 GAAGAAAGAATTTGACTGAGGGG - Intronic
943075402 2:183188114-183188136 CAGGAAAGAATTCGACTGAGGGG - Intergenic
943249225 2:185495744-185495766 GAAGAAAGAATTAGACTGAGAGG + Intergenic
943496940 2:188631813-188631835 GAGGAAAAATTTCAGCTGAGAGG - Intergenic
943903017 2:193465435-193465457 GAAGAAAGAATTCGACTGAGGGG + Intergenic
943905161 2:193490074-193490096 GAAGAAAGAATTTGACTGAGGGG - Intergenic
944024932 2:195153060-195153082 AAGAAAATAATTAGTGTGAGAGG - Intergenic
944477192 2:200119015-200119037 GAGGAAAAAATTCAGCAGAGAGG - Intergenic
944481309 2:200160435-200160457 GAAGAAATAATTCGACTGAGAGG + Intergenic
944553656 2:200867406-200867428 GAAGAAAGAATTCGACTGAGGGG - Intergenic
944586166 2:201175736-201175758 GAAGAAAGAATTTGACTGAGGGG + Exonic
945179194 2:207074612-207074634 GAGGGAATAATTTAGGTGAGGGG - Exonic
945571298 2:211471170-211471192 GATGAGACAATGAGGCTGAGAGG + Intronic
945653043 2:212588815-212588837 TAGGAAAAAATTAGGGAGAGAGG + Intergenic
945662171 2:212700078-212700100 GAAGAAATAGTTTGGCTTAGTGG - Intergenic
945775566 2:214102739-214102761 GAAGAAAGAATTCGACTGAGGGG + Intronic
946053881 2:216884825-216884847 GAGGAAATAACTCGACTGAGGGG + Intergenic
947001942 2:225466844-225466866 GAAGAAAGAATTCAGCTGAGGGG + Intronic
948638921 2:239360811-239360833 GAGAAAAGAATCAGGCTCAGGGG - Intronic
1169708716 20:8537096-8537118 GAAGAAAGAATTTGACTGAGGGG + Intronic
1170220369 20:13935641-13935663 GGGGAAATAATGAGGCAGAGAGG + Intronic
1170276152 20:14591982-14592004 CAGGAAATCATTGGGCAGAGAGG + Intronic
1170418801 20:16171964-16171986 AAGGAGATAATGAGGCAGAGAGG + Intergenic
1170667917 20:18402755-18402777 AAGGAAAGAATTTGGCCGAGAGG - Intronic
1171177074 20:23060234-23060256 GAAGAAAGAATTCAGCTGAGAGG - Intergenic
1173258366 20:41411269-41411291 GAGGAAATGACTAGGGTGGGCGG + Intronic
1174669913 20:52297573-52297595 TAGTAAATATTTAGGCTTAGTGG - Intergenic
1175631003 20:60536371-60536393 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1175682787 20:61003142-61003164 AAGGAAATAATTCAACTGAGGGG - Intergenic
1177059410 21:16352453-16352475 GAAGAAATAATTCAACTGAGGGG - Intergenic
1177170971 21:17655760-17655782 GAGGAAAGAATTTGGCTAAGGGG + Intergenic
1177179006 21:17724904-17724926 GAGGAAAGAATTCGGCAGAGGGG - Intergenic
1177530845 21:22355874-22355896 GAAGAAAAAAATAGACTGAGGGG - Intergenic
1177547664 21:22579479-22579501 GAAGAAAGAATTAGACTGAGGGG - Intergenic
1177559299 21:22729738-22729760 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1178093902 21:29193587-29193609 GATGAAAGAATTCGACTGAGGGG - Intergenic
1178187891 21:30244286-30244308 GCGGAAAGAAGAAGGCTGAGAGG + Intergenic
1178351773 21:31876728-31876750 GAGGAATTAATGAGGGAGAGAGG - Intronic
1179054736 21:37920643-37920665 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1179254818 21:39706490-39706512 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1179619135 21:42601118-42601140 GAAGAAAGAATTAGACTGAGGGG + Intergenic
1179915541 21:44475720-44475742 AAGGAAATAACTCGTCTGAGGGG - Intergenic
1184361475 22:44021597-44021619 GAGGAAATAACAAGGGTGATGGG + Intronic
949396293 3:3617642-3617664 GAGGAAAGAATTCGACCGAGAGG - Intergenic
949642168 3:6049078-6049100 GAAGAAAGAATTTGACTGAGGGG + Intergenic
950373444 3:12550710-12550732 GAAGAAAGAATTCGACTGAGGGG - Intronic
950835872 3:15918530-15918552 GAAGAAAGAATTCGACTGAGGGG + Intergenic
950918190 3:16666502-16666524 TGGGAATTAATTAGGCTTAGAGG + Intronic
950999220 3:17538615-17538637 GAGGAAAGAATTTTGCTGAAGGG - Intronic
951154964 3:19340848-19340870 GAGGAAATAATTCAGCCAAGGGG + Intronic
951450786 3:22836118-22836140 GAGGAAAAAATTCATCTGAGGGG + Intergenic
951922474 3:27871618-27871640 GAGGAAATTATTAGGCTATTAGG + Intergenic
952147695 3:30551011-30551033 GAAGAAAGAATTTGACTGAGGGG + Intergenic
952297990 3:32077887-32077909 GAAGAAAGAATTCGACTGAGGGG - Intergenic
952454131 3:33457100-33457122 GAAGAAAAAATTCGACTGAGGGG + Intergenic
953082686 3:39635392-39635414 GAAGAAAAAAAGAGGCTGAGGGG + Intergenic
953716020 3:45317703-45317725 GAAGAAAGAATTCGACTGAGGGG + Intergenic
953790090 3:45940777-45940799 GAGGAAAGAATTTGGCCGAGGGG - Intronic
953844337 3:46415365-46415387 AAGGAAATAATTAGGCTATTTGG + Intergenic
954352420 3:50055777-50055799 GAGAAAATAATCAGGATGTGGGG + Intronic
954889573 3:53912925-53912947 GAAGAAAGAATTTGACTGAGGGG + Intergenic
955319998 3:57967624-57967646 GAAGAAAGAATTTGACTGAGGGG + Intergenic
955824988 3:62936632-62936654 GAAGAAAGAATTCGACTGAGGGG + Intergenic
957287405 3:78234550-78234572 GAAGAAAAAATTCAGCTGAGGGG + Intergenic
957563165 3:81851237-81851259 GAAGAAATAACAAGGATGAGTGG + Intergenic
957621902 3:82604669-82604691 GGGGAAAAAAAAAGGCTGAGAGG + Intergenic
958435423 3:94089859-94089881 GAAGAAAGAATTAGACTGAGGGG - Intronic
958603766 3:96332065-96332087 GAAGAAAGAATTCGACTGAGAGG - Intergenic
958673296 3:97232599-97232621 TAGGAAAGAATTTGGCTGAGGGG + Intronic
959230520 3:103645217-103645239 GAGGATACAAATAGGCAGAGGGG - Intergenic
959585562 3:108022146-108022168 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
959749139 3:109812626-109812648 GAGCATATATTGAGGCTGAGAGG - Intergenic
960124260 3:113980949-113980971 AAGGAAATAATTCTGCTAAGAGG + Intronic
961393992 3:126573390-126573412 GAGGAAAGAATTCAGCCGAGGGG + Intronic
962116323 3:132512646-132512668 CAGAATATAATTAGGTTGAGGGG + Intronic
962840991 3:139232405-139232427 TGAGAAAAAATTAGGCTGAGAGG - Intronic
963064668 3:141253820-141253842 GAGGAGATAAAAAGGTTGAGGGG - Intronic
963230746 3:142906668-142906690 GAAGAAAGAATTCGACTGAGGGG - Intergenic
963684829 3:148420199-148420221 GAGGCAAGAATTCGGCTGAAGGG + Intergenic
963908855 3:150797720-150797742 GATGAAATACTGTGGCTGAGTGG + Intergenic
964328242 3:155571843-155571865 GATGATATAATTATGCTGAGAGG - Intronic
964647794 3:158977245-158977267 GAAATAATAATTAAGCTGAGAGG + Intronic
965097108 3:164244422-164244444 GATGAAACAGTTAGGCAGAGTGG + Intergenic
965208653 3:165755433-165755455 GAGGACATCCTTAGGTTGAGTGG - Intergenic
965744857 3:171913895-171913917 GAGGAAAAAGTTGGGCTGAGGGG - Intronic
966218572 3:177527915-177527937 GAGGAAAGAATTCGGCCAAGGGG - Intergenic
966538363 3:181060940-181060962 TAGGAAATAAGGAGGATGAGGGG + Intergenic
967430757 3:189382731-189382753 GAAGAAAGAATTCGGCTGAGGGG + Intergenic
968649428 4:1754562-1754584 GAGGAGGTATTCAGGCTGAGAGG + Intergenic
969335755 4:6509024-6509046 GAGGAAAGGATTCGTCTGAGGGG - Intronic
969348434 4:6583623-6583645 GAAGAAAGAATTCGACTGAGGGG + Intronic
970471102 4:16380041-16380063 GAAGAAAGAATTAGACTGAGGGG + Intergenic
970624925 4:17866214-17866236 GAGGAATTAACTAGGCCAAGTGG - Intronic
971477874 4:27089400-27089422 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
971689264 4:29811886-29811908 GAAGAAATAATTTGACTGAGGGG + Intergenic
971764684 4:30815274-30815296 GAGGAAATAATTAGGCTGAGGGG + Intronic
971860353 4:32094085-32094107 GAAGAAAGAATTTGACTGAGGGG + Intergenic
972241876 4:37202243-37202265 GAAGAAAGAATTTGACTGAGGGG - Intergenic
972275434 4:37552993-37553015 TAGAAATTAATTAGGCGGAGAGG - Intronic
972816726 4:42654284-42654306 GAGGGAATAAATAGTCTAAGAGG - Intronic
973228996 4:47820263-47820285 AGGGAAATAATGAGGGTGAGGGG + Intronic
974462351 4:62204579-62204601 GAAGAAAGAATTTGACTGAGGGG - Intergenic
974691233 4:65300072-65300094 GAAGAAAGAATTTGACTGAGGGG + Intergenic
974799918 4:66803212-66803234 GAGGAAATAAAAAGGATGAGAGG + Intergenic
975030499 4:69608582-69608604 AAGAAAATAGGTAGGCTGAGAGG + Intronic
975100936 4:70512370-70512392 GAAGAAATAATTCGACTGAGAGG + Intergenic
975222832 4:71833145-71833167 GAGGAAATAATTCAGCTGAGGGG + Intergenic
975397637 4:73895540-73895562 GAAGAAATAATTTGACGGAGGGG - Intergenic
975421706 4:74172027-74172049 TAAAAAATAATTATGCTGAGTGG + Intronic
975455493 4:74585425-74585447 GAGGAAATAGGTGGGCTGGGGGG - Intergenic
975531168 4:75401115-75401137 GAAGAAATAAGTAAGTTGAGAGG + Intergenic
975703462 4:77088993-77089015 GAAGAAAGAATTTGACTGAGGGG + Intergenic
975767213 4:77681604-77681626 GAGGAAAGAATTTGACCGAGGGG + Intergenic
976008549 4:80459572-80459594 GAAGAAAGAATTTGACTGAGGGG - Intronic
977576544 4:98680831-98680853 GAATAGATACTTAGGCTGAGAGG + Intergenic
977867770 4:102050213-102050235 GAGGCAAGAATTCAGCTGAGGGG - Intronic
978560348 4:110027297-110027319 AAGAAAGAAATTAGGCTGAGTGG - Intergenic
978587636 4:110291289-110291311 GAGGTAATAAATATGCTGATTGG + Intergenic
979047317 4:115884660-115884682 GATGCAATAATAATGCTGAGAGG + Intergenic
980156473 4:129114056-129114078 GAGTAAAAAGTTAGGCTGAGAGG - Exonic
980259789 4:130433420-130433442 GAAGAAAGAATTGGACTGAGAGG - Intergenic
980758605 4:137198746-137198768 GAGGACAGAATTTGGCTGAGGGG + Intergenic
982412105 4:155090050-155090072 GAGGAAATATTTTGGAAGAGAGG - Intergenic
983009765 4:162532745-162532767 GAAGAAAGAATTTGACTGAGGGG - Intergenic
983038686 4:162898608-162898630 GAAGAAAGAATTTGACTGAGGGG + Intergenic
983346725 4:166536159-166536181 GAGGAAATACTTAGGCAGAAAGG - Intergenic
983406308 4:167335461-167335483 GAAGAAAGAATTTGACTGAGGGG + Intergenic
983830618 4:172322333-172322355 GAAGAAAGAATTCGACTGAGGGG - Intronic
984086999 4:175325666-175325688 GAGGAAAGAATTAAGCCGAGGGG - Intergenic
984395859 4:179199216-179199238 CAGGAAATCATAAGGCTAAGGGG - Intergenic
984436569 4:179717721-179717743 GAGGAAATAATTCAGCTGAGGGG - Intergenic
986066616 5:4240625-4240647 GAAGAAATAATTTGACGGAGGGG - Intergenic
986684933 5:10268382-10268404 GAAGAAAGAATTCGGCTGAGGGG + Intergenic
986751641 5:10792992-10793014 GAAGAAAGAATTTGACTGAGAGG - Intergenic
986948264 5:13049982-13050004 GAAGAAAGAATTTGACTGAGGGG - Intergenic
986954831 5:13137888-13137910 GAAGAAATAATTCGACTGAGAGG - Intergenic
986977806 5:13412587-13412609 GAAGAAAGAATTTGACTGAGGGG - Intergenic
987664819 5:20923464-20923486 GAAGAAAGAATTCGACTGAGGGG - Intergenic
987958410 5:24770528-24770550 GAAGAAAGAATTCGACTGAGGGG + Intergenic
988131168 5:27108219-27108241 GAAGAAAGAATTTGACTGAGGGG + Intronic
988629674 5:32915318-32915340 GAAGAAAGAATTCAGCTGAGGGG - Intergenic
988819231 5:34864059-34864081 GAGGAACTAATTACGCTGAAAGG - Intronic
988972145 5:36479553-36479575 GAGGAAATAATTATTCCAAGTGG + Intergenic
989360806 5:40599419-40599441 GAGGACATAATCAGGAAGAGGGG - Intergenic
989691461 5:44149774-44149796 GAAGAAAAAATTCGACTGAGGGG - Intergenic
990114279 5:52369277-52369299 GAAGAAAGAATTTGACTGAGGGG + Intergenic
990213125 5:53502056-53502078 GAAGAAAGAATTTGACTGAGGGG + Intergenic
990341141 5:54824072-54824094 GAAGAAATAATTTGACTGAGGGG - Intergenic
990521250 5:56583679-56583701 GAAGAAAGAATTTGACTGAGGGG + Intronic
990979237 5:61586781-61586803 GAGGAAAAAAGTAGAGTGAGAGG + Intergenic
991657619 5:68919893-68919915 GAAGAAAGAATTTGACTGAGAGG + Intergenic
992399124 5:76395552-76395574 GAGGAAAGAATTCGACTGAGGGG - Intergenic
992540317 5:77757965-77757987 GAAGAAAGAATTCGACTGAGGGG + Intronic
993177254 5:84502719-84502741 GAAGAAACAATTTGACTGAGGGG + Intergenic
993390293 5:87312741-87312763 GAAGAAAGAATGAAGCTGAGAGG - Intronic
994196576 5:96929281-96929303 GAGGAAAGAATTCTGCTGAGGGG - Intronic
994281438 5:97908186-97908208 GAGGAAAGAATTTGGCTGAGGGG - Intergenic
994754018 5:103772839-103772861 GAAGAAAAAATTCGACTGAGGGG - Intergenic
995337805 5:111022195-111022217 GAGGCAATAATGAAGCTCAGGGG + Intergenic
996906759 5:128609873-128609895 GAAGAAAGAATTTGACTGAGGGG + Intronic
996939265 5:128984288-128984310 GAGGAAATAATTAAGCACTGAGG - Intronic
996953382 5:129155011-129155033 GAAGAAAGAATTTGACTGAGGGG + Intergenic
997025726 5:130058639-130058661 GAGGAAATATTTAGATTGATTGG + Intronic
998074284 5:139223762-139223784 GAGGAAATAATTTGACCAAGGGG + Intronic
998835926 5:146203250-146203272 GAGGAAGGAACCAGGCTGAGGGG + Intergenic
999985656 5:157002799-157002821 AAGGAAATAAATAGCCTTAGAGG - Intergenic
1001474170 5:172037808-172037830 GAGGAAATATCTCGGCTGGGAGG - Intergenic
1002901645 6:1414920-1414942 GAGGCGAGAATTAGGCTGTGTGG + Intergenic
1003201896 6:3969133-3969155 GAAGAAAGAATTTGGCTGAGGGG + Intergenic
1003998289 6:11566548-11566570 GAAGAAATAATTCGACTGAGGGG + Intronic
1004362841 6:14986351-14986373 GAAGAAAGAATTAGACCGAGGGG + Intergenic
1004428934 6:15526025-15526047 AAGGAAATAATTAGGATGACAGG + Intronic
1004467649 6:15900950-15900972 GAGGAAAAAATTCTGCTGAGGGG + Intergenic
1005621344 6:27623443-27623465 CAGGAAATAATTTGTCCGAGGGG + Intergenic
1005804588 6:29462391-29462413 GAGGCAAGGATGAGGCTGAGAGG - Exonic
1005812156 6:29525897-29525919 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1006017995 6:31097752-31097774 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1006173743 6:32109681-32109703 GAGGAAGGATATAGGCTGAGAGG - Intronic
1007868739 6:45007711-45007733 GGGGGAATACTTAGGGTGAGGGG - Intronic
1008516465 6:52323892-52323914 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1009273901 6:61650235-61650257 GAGAAAATAATGGGGATGAGAGG - Intergenic
1009568419 6:65346211-65346233 GAGGAACTAAGAAGGCTGACTGG - Intronic
1010057701 6:71585369-71585391 AAGGAAATCAGTGGGCTGAGGGG + Intergenic
1010105950 6:72168241-72168263 GATGAAAGAATTTGACTGAGGGG + Intronic
1010690381 6:78904020-78904042 GAGGAAAAAAGTTGGCTGTGAGG + Intronic
1010977295 6:82330054-82330076 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1011126382 6:84012445-84012467 GAGGACTTAATTAGGGAGAGGGG + Intergenic
1011307572 6:85945457-85945479 GATGAAAGAATTAGGATTAGAGG + Intergenic
1011595069 6:89008330-89008352 GAGGAAAGAATTTGACTGAGGGG - Intergenic
1013598692 6:111684317-111684339 GAAGGAATATTCAGGCTGAGAGG + Intronic
1013734256 6:113207156-113207178 GATGAAAGATTTAGGCTGAAAGG - Intergenic
1014555255 6:122837558-122837580 GAAGAAAAAATTCGACTGAGGGG - Intergenic
1014977525 6:127907180-127907202 GAAGAAAAAATTAGGCTTATAGG + Intronic
1015824855 6:137300786-137300808 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1016713013 6:147194750-147194772 GAGGAAAGAATTCAACTGAGGGG - Intergenic
1016847297 6:148581093-148581115 GAAGAAAGAATTAGACAGAGAGG + Intergenic
1017344759 6:153368147-153368169 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1017426975 6:154332056-154332078 GAGGAAAGAATTTGGCTGAGGGG - Intronic
1018091983 6:160353619-160353641 GAGAAAATAATGAAGATGAGAGG - Intronic
1018136340 6:160781551-160781573 GGGGGAATACTTAGGCAGAGAGG + Intergenic
1019817734 7:3213436-3213458 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1020389609 7:7643908-7643930 GACGAAAAAATTTGACTGAGGGG - Intronic
1020650761 7:10873075-10873097 GAGGAAATGATTAAACTGATTGG + Intergenic
1020764479 7:12303053-12303075 GAGGAAAGAATTCAACTGAGGGG - Intergenic
1020978947 7:15043978-15044000 AAGGAAATAAGTTGTCTGAGGGG + Intergenic
1021366623 7:19788043-19788065 CAGGAGATAATTAGGAAGAGTGG + Intergenic
1023052758 7:36267488-36267510 GAGGAGTTAATTAGGCCAAGAGG - Intronic
1023448967 7:40261426-40261448 GAAAAAATAATGAGGCTGAGAGG - Intronic
1026274590 7:68865429-68865451 GAGGAAAGAATTCGACTAAGGGG - Intergenic
1026899291 7:74028121-74028143 GAGGCAACAATTAGGCTTTGGGG + Exonic
1027596782 7:80184162-80184184 GAAGAAAGAATTCGGCCGAGGGG + Intronic
1027604009 7:80276800-80276822 GAGGGAATGATATGGCTGAGAGG + Intergenic
1027616559 7:80431316-80431338 GAAGAAAGAATTTGACTGAGGGG - Intronic
1028807474 7:95045176-95045198 GAAGAAATAATTCGACCGAGGGG + Intronic
1029106811 7:98183954-98183976 GAGGAAAGAATTTTGCTGAGAGG + Intronic
1029499425 7:100918954-100918976 AAGGAAATAATTCCTCTGAGGGG - Intergenic
1029907165 7:104103679-104103701 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1030134603 7:106234790-106234812 GAAGAAAGAATTAAACTGAGGGG + Intergenic
1030257745 7:107529810-107529832 GAAGAAAGAATTCGACTGAGGGG - Intronic
1030497515 7:110317917-110317939 GAGGAAATAATGAGTCTAAAAGG - Intergenic
1030515555 7:110533806-110533828 GAAGAAAGAATTTGACTGAGAGG - Intergenic
1030816844 7:114049335-114049357 GAAGAAAGAATTTGGCTGAATGG - Intronic
1031469477 7:122151858-122151880 GAAGAAATAATTCAGCTGAGGGG + Intergenic
1031637210 7:124116539-124116561 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
1031726397 7:125245162-125245184 GAGAAAATAAATAGGCTGTTTGG + Intergenic
1031765279 7:125770292-125770314 GAAGAAAGAATTGGACTGAGGGG + Intergenic
1032279585 7:130490449-130490471 GAGGAAGTAATTAAGGGGAGGGG - Intronic
1032460021 7:132103339-132103361 GAGGAAAGAAGGAGGCTGAGGGG + Intergenic
1033446663 7:141428882-141428904 GAGGAAAGAATTCAGCTGAGGGG - Intronic
1033873413 7:145785125-145785147 GAAGAAACAACTAGACTGAGGGG - Intergenic
1034170342 7:149058090-149058112 GAAGAAAGATGTAGGCTGAGAGG - Intergenic
1034183413 7:149156098-149156120 GAGGAAATACTAAGGCAGGGAGG + Intronic
1035157832 7:156928692-156928714 GAAGAAAGAATTCAGCTGAGGGG - Intergenic
1036044199 8:5121858-5121880 GAGGAAAGAATTCTGCTGAGGGG + Intergenic
1036343899 8:7942547-7942569 GAAGAAATAATTTGACTGAAGGG + Intronic
1036466467 8:9002653-9002675 AAGGAAAAAAGTAGGGTGAGTGG - Intronic
1036839240 8:12103314-12103336 GAAGAAATAATTTGACTGAAGGG + Intergenic
1036861030 8:12349557-12349579 GAAGAAATAATTTGACTGAAGGG + Intergenic
1037499500 8:19471535-19471557 GAAGAAAGAATTCGACTGAGGGG - Intronic
1037968977 8:23158229-23158251 GAAGAAAGAATTGGACTGAGGGG - Intronic
1038404723 8:27312965-27312987 GAAGAAAGAATTAGACTGAGGGG + Intronic
1039095964 8:33885662-33885684 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1039500062 8:38009588-38009610 AAGGAAAGAATTCGACTGAGGGG - Intergenic
1039959212 8:42232817-42232839 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1040912254 8:52530987-52531009 GAAGAAAGATGTAGGCTGAGAGG - Intergenic
1041033305 8:53760615-53760637 GAGGAAATAATTCTGCTGAGGGG - Intronic
1041386178 8:57305805-57305827 GAAGAAATAATTCAACTGAGGGG + Intergenic
1041450043 8:57995818-57995840 GAGGACATAAGTTGGCTGTGAGG - Intronic
1042015019 8:64299331-64299353 TAGGTAACATTTAGGCTGAGAGG - Intergenic
1042396464 8:68296606-68296628 GAGGAAAGAACTCGGCTGAGGGG - Intergenic
1042480119 8:69293164-69293186 GAAGAAATATATAGGGTGAGTGG - Intergenic
1042863129 8:73333594-73333616 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1042873290 8:73417458-73417480 GAGGAATAAATTAGGTTGATTGG + Intergenic
1043884993 8:85588585-85588607 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1044085513 8:87937779-87937801 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1044088260 8:87968660-87968682 GAAGATATAATTGGACTGAGGGG - Intergenic
1044090446 8:87993849-87993871 GAGGAAAAGATTAGGCTGCATGG - Intergenic
1044602991 8:94024470-94024492 GAGGGCAGAATTAGGATGAGTGG + Intergenic
1044897327 8:96906238-96906260 GAGGGAAAACTAAGGCTGAGAGG - Intronic
1045427761 8:102084321-102084343 GAAGAAGTAATTTGACTGAGGGG + Intronic
1046184300 8:110692971-110692993 GAGGAAAGAATTTGACTAAGGGG + Intergenic
1046400592 8:113698877-113698899 GAGAAAATAATTCTGTTGAGAGG + Intergenic
1047816477 8:128469543-128469565 GAGGAAAAATTGAGGCTCAGAGG + Intergenic
1048128461 8:131663807-131663829 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1048926929 8:139279853-139279875 GAGGAAGAAATGAGGCTCAGGGG - Intergenic
1049533861 8:143169098-143169120 GAGGGAACACTTAGGCCGAGAGG - Intergenic
1050204965 9:3186674-3186696 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1050423629 9:5492046-5492068 GAGGAACTAATTAAGGTGAATGG - Intergenic
1050815554 9:9807159-9807181 ATGGAAATAATTCTGCTGAGGGG - Intronic
1051080549 9:13288779-13288801 GAAGAAAGAATTAAACTGAGGGG - Intergenic
1051725343 9:20083237-20083259 GAGCAAGTAGCTAGGCTGAGAGG - Intergenic
1051744613 9:20283581-20283603 GAAGAAATAATTCAACTGAGGGG + Intergenic
1051888747 9:21922514-21922536 AAGGAAAGAATTTGTCTGAGGGG - Intronic
1052380064 9:27760471-27760493 GATGAAATCAATGGGCTGAGAGG + Intergenic
1052547605 9:29900375-29900397 GAAGAAATAATTAGACTGAGGGG + Intergenic
1052634513 9:31084559-31084581 GAATAATTCATTAGGCTGAGTGG - Intergenic
1052819299 9:33126202-33126224 GAGGAAGGAACTAGGCCGAGTGG + Intronic
1052867920 9:33476993-33477015 GAGGTGATATTTATGCTGAGAGG - Intergenic
1054986272 9:71265374-71265396 GAGGAAATCATTTGGATGAGAGG + Intronic
1055003161 9:71476522-71476544 GAGGAAATAATTAGGAATGGAGG - Intergenic
1055136629 9:72836833-72836855 GAGGGAAGAATTCAGCTGAGGGG + Intergenic
1055998767 9:82192266-82192288 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1056435179 9:86569028-86569050 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1058278192 9:103074462-103074484 GAAGAAAGAATTAGACTGAGAGG + Intergenic
1058365850 9:104207238-104207260 GAGGAAAGAATTCAGCTGAGAGG - Intergenic
1059219804 9:112604208-112604230 GAGGAAATAATTAGATTAATGGG + Intronic
1059392009 9:114005348-114005370 CAGGAAATGATTAGGCCAAGAGG - Intronic
1061865971 9:133491954-133491976 GAGGAAAGGATTAGGCTGCCTGG + Intergenic
1186664774 X:11705669-11705691 GAAGAAAGAATTCGACTGAGGGG + Intergenic
1187509939 X:19908622-19908644 GAAGAAAAAATTGGACTGAGAGG + Intergenic
1187831358 X:23385263-23385285 GTGGAAATAAATAGGTTTAGGGG + Intronic
1188284488 X:28311484-28311506 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1188865784 X:35311706-35311728 GAAGAAATAAGTTGACTGAGGGG + Intergenic
1188898617 X:35700172-35700194 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1188953688 X:36408207-36408229 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1188989798 X:36803587-36803609 GAGGAAAGAATTCTGCTGAGGGG - Intergenic
1189031874 X:37459724-37459746 GAGGAAATTGTTGGGCTGATTGG + Intronic
1189780355 X:44508058-44508080 GAGGAAAGAATTTGGCCAAGGGG + Intergenic
1189987770 X:46569421-46569443 GTGGAAATAATCTGGTTGAGAGG + Intergenic
1190758995 X:53424143-53424165 GGAGAAACAATCAGGCTGAGGGG + Intronic
1190771861 X:53521456-53521478 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1193054822 X:77138594-77138616 CAGGAAATAGCTAGGGTGAGGGG - Intergenic
1193336744 X:80298630-80298652 GAGGAAATAATTGGCCACAGGGG + Intergenic
1193518727 X:82503051-82503073 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1193731864 X:85111978-85112000 GAAGAAAGAATTAGACTGAGGGG + Intergenic
1193818475 X:86131702-86131724 AAGGCAAGAATTAGACTGAGAGG - Intergenic
1193919196 X:87405138-87405160 GAAGATACAATTAGGCTGAGGGG - Intergenic
1193968691 X:88022851-88022873 GAAGAAATAATTCTACTGAGAGG + Intergenic
1193974400 X:88099521-88099543 GAAGAAAGAATTAGACTGAGGGG + Intergenic
1194130931 X:90080889-90080911 GAAGAAAGAATTTGGCTGAAGGG + Intergenic
1194553050 X:95324780-95324802 GAAGAAAAAATTTGACTGAGGGG + Intergenic
1194627593 X:96243650-96243672 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1194849725 X:98856144-98856166 GAGGAAATAATTTAACTGAGGGG - Intergenic
1195220432 X:102741113-102741135 GAAGAAAGAATTTGACTGAGGGG + Intronic
1195256794 X:103098823-103098845 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1195718702 X:107844404-107844426 GAGAAAATAATTACTCTGATAGG - Intronic
1196323997 X:114379682-114379704 GAAGAAAAATATAGGCTGAGAGG + Intergenic
1196742770 X:119039981-119040003 TATGAAATAATTAAGTTGAGAGG + Intergenic
1197017868 X:121649022-121649044 GGGGAAATAATGAGACTGGGTGG - Intergenic
1197555259 X:127945604-127945626 GAGGAAAGAATTTGACTGAAAGG + Intergenic
1197837690 X:130712856-130712878 GAAGAAAGAATTCGACTGAGGGG - Intronic
1198245541 X:134827745-134827767 GAGGAAACACTCAGGCAGAGAGG - Intronic
1198666097 X:139025021-139025043 GAGGCATTTATTAGGCTGGGAGG - Intronic
1198957792 X:142150679-142150701 GAAGAAATAATTTGACTGAGGGG - Intergenic
1199009348 X:142740500-142740522 GAAGAAAAAATTCGACTGAGCGG - Intergenic
1199219344 X:145298996-145299018 GAAGAAATAATTTGACCGAGGGG + Intergenic
1199615299 X:149651182-149651204 GAAGAAAGAATTCGACTGAGGGG - Intergenic
1201737071 Y:17279158-17279180 GAGGAAACACTTAGGATGAAGGG - Intergenic
1201754537 Y:17471597-17471619 GAAGAAAGAATTTGGCTGAGGGG + Intergenic
1201847015 Y:18434388-18434410 GAAGAAAGAATTTGGCTGAGGGG - Intergenic
1202046880 Y:20744425-20744447 GAGGAAAGATTTCCGCTGAGAGG - Intergenic
1202143359 Y:21752202-21752224 GAAGAAAGAATTTGACTGAGGGG - Intergenic
1202352906 Y:24012792-24012814 GAAGAAAGAATTTGACTGAGGGG + Intergenic
1202517873 Y:25657323-25657345 GAAGAAAGAATTTGACTGAGGGG - Intergenic