ID: 971764863

View in Genome Browser
Species Human (GRCh38)
Location 4:30817848-30817870
Sequence GTGTTTTAAAAGAAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 388}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971764863 Original CRISPR GTGTTTTAAAAGAAGTGTTC TGG (reversed) Intronic
901730559 1:11276072-11276094 ATGTTTTAAAAGAATTGCTCTGG + Intronic
901848879 1:12002383-12002405 TTGTTTTGAAAAATGTGTTCAGG - Intronic
901897118 1:12323487-12323509 GTGTTTTTAAAGTGGTGTCCTGG - Intronic
902055322 1:13595895-13595917 ATAATTTTAAAGAAGTGTTCCGG + Intronic
902258399 1:15205938-15205960 TCATTTTAAAAGAAATGTTCAGG + Intronic
903834412 1:26193636-26193658 GTGTTTTAAAGGAAGTGACAAGG + Intronic
905377951 1:37537463-37537485 GTGTTTTAGTAGAAGTGTTGTGG - Exonic
905470175 1:38185877-38185899 GTGTTTTAGAAAGAGTGCTCTGG - Intergenic
905608046 1:39321887-39321909 GGGTTTTAGAAAAAGTATTCTGG + Intronic
905774416 1:40659413-40659435 GTGTTTTAGAAAGATTGTTCTGG + Intronic
905920307 1:41714883-41714905 GTGTTTTAAAAGGAGTTTTCTGG + Intronic
906135020 1:43492757-43492779 CTATTTTAAAAGAAGGGGTCAGG + Intergenic
907129334 1:52081422-52081444 GTGGTTTAAAAGAGGATTTCAGG - Intronic
907228021 1:52967662-52967684 CTGTTTTGAAAGAAGGGGTCAGG + Intronic
907699661 1:56772877-56772899 GTATTTTAAAATAAGTTTTGAGG + Intronic
908732175 1:67237375-67237397 TTGTTTTGAAAGAAGTTTTTGGG - Intronic
909402644 1:75251357-75251379 GTTATTTATAAAAAGTGTTCAGG - Intronic
910499070 1:87868099-87868121 GTCTTTTAATTGAAGTGTTCAGG - Intergenic
911255425 1:95627811-95627833 GTGTTTTAACAGAACCATTCTGG + Intergenic
913228283 1:116719960-116719982 ATGTTTTAAATGAAGTGTCTAGG - Intergenic
913511079 1:119563115-119563137 ATGTTTTAAAACAAGAGGTCAGG - Intergenic
915084725 1:153377779-153377801 GTGTTTTAAGTGCAGTGTTTAGG - Intergenic
915239595 1:154510744-154510766 GTATTTTAAAAAAACTTTTCAGG + Intronic
915646367 1:157275594-157275616 GTGTTTACACAGAAGTGTGCAGG + Intergenic
916454852 1:164960314-164960336 GTGGCTTAAAGGAACTGTTCAGG + Intergenic
916476454 1:165174013-165174035 GTGGTTTAAAAAAAGTCATCCGG + Intergenic
917119071 1:171629968-171629990 GTGTTTTAATGGGATTGTTCTGG + Intergenic
918030727 1:180806823-180806845 GTGATTTAAAAAAAATGATCTGG + Intronic
919730081 1:200908236-200908258 GTTTTTTAAAAGAAGGGAGCAGG + Intronic
920668269 1:207982628-207982650 GTGCTTTAAAAGAAGTGTTTGGG + Intergenic
922997949 1:229981939-229981961 ATGTTTTTAAAGAAGTGCCCTGG + Intergenic
923212264 1:231814178-231814200 ATGTTTAAAAGGAAGTGTTCTGG + Intronic
923352528 1:233123273-233123295 GTTTTTTAAAAGATGTATTTTGG - Intronic
923438773 1:233995469-233995491 TTATTTTAAATGAAGTGTTAAGG + Intronic
1063261504 10:4394331-4394353 TTGTTTAAAAAGGACTGTTCAGG + Intergenic
1064954885 10:20896849-20896871 GTGTTTTAAAAGGTGATTTCAGG + Intronic
1065638642 10:27757145-27757167 GCCTTTTAAAAGAAGGATTCAGG + Intergenic
1065954927 10:30684980-30685002 GTGTTTACAAAGAATTGTTCTGG + Intergenic
1066198306 10:33123145-33123167 GTGTTTTAACATAAGAGTTTTGG - Intergenic
1066314401 10:34229544-34229566 GTATTTAAAAAGAAGAGTTGGGG - Intronic
1066668954 10:37816834-37816856 GTGTTTTAGGAGAAGGGTGCTGG + Intronic
1067319372 10:45203317-45203339 TTGATTTAAAATAATTGTTCAGG + Intergenic
1067450316 10:46378029-46378051 GTTTTAGAAAATAAGTGTTCTGG - Intronic
1067498131 10:46776842-46776864 GTTTTTTAAAAAATGTGTTGGGG + Intergenic
1067586929 10:47481734-47481756 GTTTTAGAAAATAAGTGTTCTGG + Intronic
1067596514 10:47563573-47563595 GTTTTTTAAAAAATGTGTTGGGG - Intergenic
1067633986 10:47989501-47989523 GTTTTAGAAAATAAGTGTTCTGG + Intergenic
1068512287 10:57982078-57982100 GTGTTTTAAAAGAATCAGTCTGG - Intergenic
1068742529 10:60490326-60490348 GTGTGTTAAAACAAATGTTCTGG - Intronic
1069200240 10:65605970-65605992 GTGTTTTAAAAGTAATGAACTGG + Intergenic
1071403500 10:85303009-85303031 GAGTTTTAAAAGCAGAGTTATGG + Intergenic
1075820368 10:125302712-125302734 GTTTTTTAAAGGAAGTCTTTTGG + Intergenic
1079171470 11:18100080-18100102 GTGTTTTAAATGAACTCTTAGGG - Intronic
1081363179 11:42204940-42204962 GTGTTTTAAGAGAAATACTCAGG + Intergenic
1082972622 11:59039499-59039521 TTGTTTTAAAAGGAGTGTTCTGG + Intronic
1083785485 11:64943359-64943381 CTGTTTCATAAGAAGTGTTTAGG - Intronic
1084997523 11:72996160-72996182 TTGTTTTAAAAGCATTGTACAGG + Intronic
1085062930 11:73464658-73464680 GTGTTTTGAAGAAAGTGTTGGGG - Intronic
1085107137 11:73854722-73854744 GTTTTTTAAAGAAAGTGTTTTGG - Intronic
1086667201 11:89497236-89497258 CTGTGTTAATAGATGTGTTCAGG - Intronic
1086733074 11:90272673-90272695 CTGTTTTAAAAGATTTTTTCTGG + Intergenic
1087062196 11:93990692-93990714 GTGTTTAAAAAGAACTGCTGAGG + Intergenic
1087443267 11:98212246-98212268 TTGATTTATAAAAAGTGTTCTGG + Intergenic
1087494088 11:98867061-98867083 ATGGTATAACAGAAGTGTTCAGG - Intergenic
1088894080 11:114064690-114064712 GAACTTTAGAAGAAGTGTTCTGG - Intronic
1089809970 11:121123696-121123718 CTGCTTTAAAAGAATTGCTCTGG - Intronic
1089819786 11:121213885-121213907 GTCTTTTAAATGGAGTGTTTAGG - Intergenic
1090496271 11:127215648-127215670 GTGCCTAAAAAGAAGTGCTCAGG + Intergenic
1091745154 12:2987245-2987267 GGGTTTAAAAAGAAGAGGTCAGG + Intronic
1092221146 12:6714678-6714700 CTGTTTTAAAGGAAGGGTCCAGG - Intergenic
1092302493 12:7265185-7265207 CTGTTTTAAAAGAAGGGGTGGGG + Intergenic
1092559570 12:9596979-9597001 ATGATTTAAAATAAGTGTTCTGG - Intronic
1092737655 12:11598412-11598434 TTGATTTATAGGAAGTGTTCTGG - Intergenic
1094702742 12:32885961-32885983 GTGGTTTAAAAAAAGTGATTTGG + Intronic
1095332189 12:40979905-40979927 GAGTCTTAGAAGAATTGTTCTGG - Intronic
1097544357 12:60980069-60980091 GTGTTTTAAAAGTAGTGTGTAGG - Intergenic
1098957752 12:76705089-76705111 GTGTTCTATAAAAATTGTTCTGG - Intergenic
1099601364 12:84742615-84742637 GTTTTTTAAAAGAATTATTCTGG - Intergenic
1099691017 12:85951517-85951539 GTGTTATGATACAAGTGTTCTGG - Intergenic
1099710962 12:86223749-86223771 GAGTGTTAGAAGGAGTGTTCAGG - Intronic
1100177957 12:92052072-92052094 ATGTTTTAAAAGGAGCATTCTGG - Intronic
1100933380 12:99636588-99636610 GTTTTTTAAAAAAAATTTTCTGG - Intronic
1104525713 12:129519353-129519375 GTGATTTCAAGTAAGTGTTCAGG - Intronic
1105457062 13:20550703-20550725 CTGTTTTAAAGGAAGGGTCCAGG + Intergenic
1105574422 13:21636916-21636938 GTATTTTAAAAGAAATCATCTGG + Intergenic
1106467788 13:30028134-30028156 GTGTTTTTAAAGAATTGAGCTGG + Intergenic
1106957367 13:34954950-34954972 ATATTTTAAAAAAAGTTTTCTGG + Intronic
1107141906 13:37007935-37007957 CTTTTTAAAAAGAAATGTTCTGG + Intronic
1107274251 13:38658828-38658850 GTGATTTAAGGGAAGTTTTCTGG - Intergenic
1107304954 13:39008032-39008054 ATGTTTAATTAGAAGTGTTCTGG + Intergenic
1109175468 13:59150013-59150035 GTGTTTTAAAAATAGCATTCTGG - Intergenic
1109778047 13:67069422-67069444 ATTTTTTAAAAGAATTGTACAGG - Intronic
1109876584 13:68412315-68412337 CTCTTTTAAAAGAACTGTTCAGG - Intergenic
1110127281 13:71961648-71961670 GTGACTTTAAAGAAATGTTCTGG - Intergenic
1110848943 13:80222404-80222426 GTGGTTTTAAAGTTGTGTTCAGG + Intergenic
1110966907 13:81711600-81711622 GTCTTTTAAGTGAAGTGTTTAGG + Intergenic
1111664748 13:91253172-91253194 CTGTTTTAAAAAAATTGTGCAGG + Intergenic
1111703802 13:91723013-91723035 GTGTTTTAAAAGTGGTATTATGG + Intronic
1112803729 13:103139280-103139302 GTATTTTAAAGGGAGAGTTCTGG + Intergenic
1115824663 14:37255120-37255142 ATGTGTTACAAGAGGTGTTCTGG - Intronic
1116611819 14:47084170-47084192 GTGGTTTAAAAAATATGTTCAGG - Intronic
1116737051 14:48704680-48704702 TAGTTTAAAAAGAAGTTTTCAGG - Intergenic
1116754847 14:48934953-48934975 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1117108064 14:52419225-52419247 GTGTTTTTAAAATTGTGTTCTGG - Intergenic
1117688901 14:58284889-58284911 GAGTTTTCTAAGAAGTGCTCAGG + Intronic
1117892431 14:60440610-60440632 AGGTTTTAAAAGAATTATTCTGG - Intronic
1119218595 14:72888316-72888338 GAGTTTTAAAAGCAGTGGTTAGG - Intronic
1119342540 14:73891882-73891904 GTATTTTAAAAGAAGTGTTTCGG + Intronic
1120144509 14:80965001-80965023 CTGTTTTAAAGAAAGTGTCCAGG + Intronic
1121594990 14:95156034-95156056 GTTTATTAAAAGATGGGTTCGGG - Intronic
1122753627 14:103959035-103959057 GTGTTTTACAAAAAGTGCTTTGG + Intronic
1123487804 15:20756543-20756565 GTGTTTTAGAAGATGTATTCAGG + Intergenic
1123544303 15:21325620-21325642 GTGTTTTAGAAGATGTATTCAGG + Intergenic
1125021982 15:34994916-34994938 GAGTATTAAGAGAACTGTTCAGG - Intergenic
1125241376 15:37581294-37581316 GTGTTTTAAAAGAATTACTTGGG - Intergenic
1125298316 15:38226850-38226872 GCGATTTAAAAAAATTGTTCTGG - Intergenic
1125803135 15:42468376-42468398 GCCATTTAAAAGAAGTGTTTTGG - Intronic
1125842076 15:42812355-42812377 GAGTTTTAAAAAAATTGTCCTGG + Intronic
1126176312 15:45739055-45739077 GATTTATAAAAGAAGTTTTCAGG + Intergenic
1127380012 15:58422801-58422823 GTGTTTGAAAGGAAGTTGTCAGG - Intronic
1128116242 15:65108237-65108259 GTCTTTTAAATAAATTGTTCTGG + Intronic
1128321366 15:66696994-66697016 GTGGTTTAAAGGAAGTGATCAGG - Intergenic
1128832472 15:70782009-70782031 CTGTTTTATAGGAAGTGTTGTGG - Intergenic
1128952422 15:71900132-71900154 GTGATTAAAAATAAGTTTTCTGG + Intronic
1128953366 15:71911625-71911647 GTTTTTTAAAAGAAGTTTTGTGG - Intronic
1130053747 15:80505252-80505274 GTGTTTTAAGTGAAGAATTCTGG + Intronic
1130917381 15:88316153-88316175 GTGTTTTAAAATATGTATTCTGG - Intergenic
1131265962 15:90915584-90915606 GTGTGTTAAAAGTAGGGCTCTGG - Intronic
1202952648 15_KI270727v1_random:52891-52913 GTGTTTTAGAAGATGTATTCAGG + Intergenic
1133473812 16:6100713-6100735 GTGTTTTAAAAGAAGAATCCCGG + Intronic
1134433819 16:14236560-14236582 GTCTTTTAAATGAGGTGGTCTGG + Intronic
1135587843 16:23684326-23684348 GTGATTTGAAAGAATTTTTCAGG - Intronic
1136524750 16:30821861-30821883 CTGTTTTGAAAGAAGGGGTCAGG - Intergenic
1138218743 16:55230657-55230679 GTGGTTTCAAACATGTGTTCTGG + Intergenic
1139499860 16:67353927-67353949 GTGTTTTAAGAGAATTAATCTGG - Intronic
1139615817 16:68090304-68090326 GTGTTTTTAAAGAAATGTTGGGG - Intronic
1140808746 16:78557016-78557038 GTGTTTTAAAGTAAGTTTGCCGG - Intronic
1141056398 16:80819179-80819201 GTGTTTTAAAAGCAAGATTCTGG + Intergenic
1141996121 16:87637440-87637462 GTGTTTTAAATGAAGGCTTGTGG + Intronic
1143671631 17:8400086-8400108 GTGTTCTAAAAAAAGAATTCTGG + Intergenic
1145239692 17:21233266-21233288 TTGTTTTAAAAGAATTATTGTGG - Intergenic
1146502434 17:33375545-33375567 GCGTTTTAAAAGGATAGTTCTGG + Intronic
1147132319 17:38416748-38416770 GGGGTTTAAAAAAAATGTTCCGG - Intergenic
1147832813 17:43308891-43308913 GTATATTAAAAGAAGTAATCCGG + Intergenic
1147941387 17:44050823-44050845 GTATTTTATTAGAAATGTTCAGG - Intronic
1150175415 17:63049711-63049733 GTGTTTTAACAGAACCATTCTGG + Intronic
1151514602 17:74584708-74584730 CTGTTTTGAAAGAAGGGGTCAGG - Intronic
1152167061 17:78716299-78716321 GTATTTTAAAGCAAGTATTCAGG - Intronic
1153235392 18:2981184-2981206 GTGATTTGTAAGGAGTGTTCAGG + Intronic
1156611083 18:38724989-38725011 GTGTTATAAGAAAACTGTTCTGG + Intergenic
1158274971 18:55757289-55757311 GCCTTTTAACAGAAGTCTTCAGG + Intergenic
1158407525 18:57173349-57173371 GAATTTTTAAAGAAGGGTTCTGG - Intergenic
1159156877 18:64595453-64595475 CTGTTTTAAAGGAAGGGATCGGG + Intergenic
1159460071 18:68713215-68713237 ATGTTTTAGCAGAAGTGCTCAGG + Intronic
1162045394 19:7996488-7996510 GAGCTTAAAAAAAAGTGTTCTGG - Intronic
1162257944 19:9508098-9508120 CTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1162258694 19:9514701-9514723 CTGTTTTAAAAGAAGGGGTTGGG + Intergenic
1163336255 19:16674081-16674103 GTCTCTTAAAAAAAGTGTCCAGG + Intronic
1163906618 19:20154300-20154322 TTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1164491709 19:28720742-28720764 GTGTTTTAAAAGGTTCGTTCTGG - Intergenic
1165086889 19:33355496-33355518 CTGCTTGACAAGAAGTGTTCAGG - Intergenic
926057150 2:9780587-9780609 GTGTTTCAACAGCAGTGTTGAGG - Intergenic
926080951 2:9985964-9985986 GTTTTTAAAAAGAGGTGATCAGG - Intronic
927093783 2:19732175-19732197 GGGCTTTAAAAGAAGTGCCCAGG - Intergenic
927324689 2:21790775-21790797 CTGTTTTAAAGGAAGGGTCCAGG - Intergenic
927584888 2:24293327-24293349 CTGATTTTAAAGAACTGTTCAGG - Intronic
928993095 2:37256286-37256308 GTGGTTAAAGAGAAGTGTTTGGG + Intronic
931442544 2:62300933-62300955 GGGTTTTAGAAGAAGGATTCCGG + Intergenic
931512677 2:63017858-63017880 TTGTTTTAAAAGGAGAGTTTAGG + Intronic
932286705 2:70540004-70540026 GTGTTTTATAAGAATTGGGCCGG - Intronic
933259670 2:80118205-80118227 ATGTTTTACAAAAAATGTTCAGG - Intronic
935419957 2:102856711-102856733 ATCTGTTAAAAGAAGTGCTCTGG + Intergenic
935836704 2:107062852-107062874 TTATTTTAAAAGCAGAGTTCTGG - Intergenic
935996202 2:108776015-108776037 GTGTTTTAAAGGGAGTTTTCAGG - Intronic
936413050 2:112277043-112277065 GGGTTTTAAAAAACGTGTTTAGG - Intronic
937012761 2:118576495-118576517 CTCTGTTTAAAGAAGTGTTCTGG - Intergenic
937269489 2:120639312-120639334 GTCTTTTTAGAGAAGTATTCTGG + Intergenic
937426810 2:121806758-121806780 GAGGTTTAAATGAAGTGTTACGG - Intergenic
938675650 2:133631228-133631250 GGTTTTTAAAATAAGTCTTCAGG - Intergenic
938906974 2:135846640-135846662 TTGTTTTAAAATTAGTGTTAAGG - Intronic
939145084 2:138403912-138403934 CTGTTTTAAAAGAAGGGGTCAGG - Intergenic
939215414 2:139231404-139231426 GTGTTTTAAAAGATCTGTCCTGG - Intergenic
940913935 2:159234014-159234036 ATTTTTTAAAATAAGTGTTAAGG - Intergenic
941758927 2:169219519-169219541 GTGTTTTAGAAAAATTGGTCAGG - Intronic
942100577 2:172578900-172578922 GTGTGTGTATAGAAGTGTTCAGG + Intronic
942275219 2:174316761-174316783 GGTTTTTAAAAGTAGTGTTCTGG + Intergenic
942406608 2:175662718-175662740 GGGTTCTGAAAGAAGAGTTCTGG + Intergenic
942474479 2:176303099-176303121 TTGTTTTAAATGAGTTGTTCAGG + Intronic
942884051 2:180900433-180900455 TTGTTTTAAAAGTAGCATTCTGG - Intergenic
943989514 2:194669905-194669927 GGGTCTTAAAAGAAGCATTCTGG + Intergenic
944462495 2:199965428-199965450 ATGTTTTATAAGAAATGTTAAGG + Intronic
944467427 2:200017331-200017353 GGTTTTAAAAAGAAGAGTTCTGG - Intergenic
944954323 2:204790498-204790520 GTGTGTTATAAGAAGTGTTCTGG + Intronic
944982096 2:205133041-205133063 TTGGTTTAAAAGAATTGTACAGG - Intronic
945480108 2:210335603-210335625 GTCTTTTAAATGGAGTGTTTAGG + Intergenic
945520774 2:210824518-210824540 GTGTCTTAAAAGCAGTTTTTAGG - Intergenic
946199235 2:218061940-218061962 TTATTTTGAAAGAAATGTTCTGG + Intronic
946209239 2:218134110-218134132 TTATTTTAAAAGATGTATTCTGG - Intronic
946272877 2:218608841-218608863 GTGTTATAAAAGAACTGGCCGGG + Intronic
946380141 2:219342292-219342314 GTGTCTTAAAAGTAATCTTCTGG + Intergenic
947469383 2:230386460-230386482 TTGTTTTAAAATAATTGTTATGG - Intronic
1168781332 20:493458-493480 GCTTTTTAAAAGGATTGTTCAGG + Intronic
1169710269 20:8553428-8553450 GTATTTTAAAACAAGATTTCTGG - Intronic
1170393761 20:15903758-15903780 ATATTTTAAAAGAAATCTTCTGG + Intronic
1171722755 20:28580863-28580885 ATGTTTTAATATAAGTGTTGTGG - Intergenic
1171951024 20:31422483-31422505 GTTTTTTAAAAAAAGTTTACTGG - Intergenic
1173368191 20:42408007-42408029 GTATTTTAAAAAATTTGTTCAGG - Intronic
1174325716 20:49777239-49777261 CTGTTTCAAAAAAAGTGATCAGG - Intergenic
1174877077 20:54238436-54238458 GTGTTTTTTAAGATGTTTTCTGG - Intergenic
1175605160 20:60306759-60306781 GTGTTTTGGAAGAAATGTCCTGG + Intergenic
1176588942 21:8621350-8621372 GTGTTTTAACAGAATTTCTCTGG - Intergenic
1177883245 21:26718938-26718960 ATATTTTAAAAGCAGTGTTTAGG + Intergenic
1178701496 21:34837135-34837157 CTGCTTTAGCAGAAGTGTTCAGG + Intronic
1179304247 21:40140697-40140719 GTGTTTTAAAACTTGTGTTTAGG + Intronic
1180271769 22:10598347-10598369 GTGTTTTAACAGAATTTCTCTGG - Intergenic
1180296308 22:10939542-10939564 ATGTTTTAATATAAGTGTTGTGG - Intergenic
1182765320 22:32753993-32754015 GGGGATTAAAAGAAGAGTTCTGG - Intronic
1182983476 22:34694953-34694975 GTGTCTTAAAAGAAGAGTTAAGG - Intergenic
949288921 3:2440128-2440150 ATTTTTTAAAAAAAGTGATCTGG - Intronic
949314636 3:2738378-2738400 TTGCTTTAAAAGAAGTATTTAGG - Intronic
949423819 3:3894548-3894570 GTGTTCAAAAAGAATTATTCAGG + Intronic
950468332 3:13169022-13169044 TTGTTTTAAAAGAATTTTGCAGG - Intergenic
951196552 3:19829610-19829632 TTGTTTTAAATGAAATGCTCCGG - Intergenic
951982953 3:28585954-28585976 GTGTTTTAAAAGTAGCCCTCAGG + Intergenic
952093741 3:29923165-29923187 ATGTTTTCAAGGAAGTGATCAGG + Intronic
952423992 3:33156339-33156361 GTGTTTTAAAAGATGCATTTGGG - Intronic
952709107 3:36411541-36411563 GACTCTTAAAAGAAGTGCTCAGG + Intronic
953093061 3:39748804-39748826 GTGATTTAAAAGAGATGTTTAGG - Intergenic
954981416 3:54749056-54749078 ATGTTGTAACAGAATTGTTCAGG + Intronic
955403012 3:58606971-58606993 GTGTCTTAAATGAAGTCTTCAGG - Intronic
955439867 3:58943650-58943672 TTGGAGTAAAAGAAGTGTTCTGG - Intronic
955588232 3:60505470-60505492 ATGTTTTAAAAGAAGTTTTAGGG - Intronic
956012648 3:64848035-64848057 GTTATTTAAAATAAGTGTTTTGG + Intergenic
956096263 3:65720035-65720057 GTGTTTTAAATGGAGTCTTTGGG + Intronic
956879986 3:73500553-73500575 GTGTTTTAAGAGGATTATTCTGG - Intronic
957862104 3:85966913-85966935 TTATTTTAAAAAGAGTGTTCTGG + Intronic
959121951 3:102242983-102243005 GAGCTCTAAAAGAAGTCTTCTGG + Intronic
959218828 3:103488163-103488185 GTTTTTTAGATGAAGAGTTCTGG + Intergenic
959297906 3:104560798-104560820 GTGTTTTGAAAGGATTTTTCTGG + Intergenic
960715521 3:120571276-120571298 GCATTTTAAAAATAGTGTTCTGG - Intergenic
960871532 3:122254541-122254563 TTATTTAAAAAGAAGTCTTCAGG - Intronic
961837850 3:129678919-129678941 ATGTTTTAAAAGAACTACTCTGG - Intronic
962070869 3:132033254-132033276 GGATTTTAAAAGCACTGTTCTGG - Intronic
962942440 3:140137954-140137976 CTGTTTTAACAGAAGTCTTAAGG + Intronic
963311433 3:143714544-143714566 GTGTTTTAAAATAACCATTCTGG - Intronic
964069104 3:152610572-152610594 TTGTTTGAAAAGAAGTGATTTGG - Intergenic
964293770 3:155211141-155211163 ATGTTTTGAAAGCAGTTTTCAGG + Intergenic
964413595 3:156424876-156424898 GTGTCTTATTACAAGTGTTCAGG - Intronic
965696412 3:171413023-171413045 GTGTTTAAAAAGAGGAGTTGAGG - Intronic
966483287 3:180436826-180436848 GTGATTTATAAGAAGACTTCTGG + Intergenic
966819332 3:183912652-183912674 GTGTTTGCAAAGATGTGTTAGGG + Intergenic
968336160 3:197915482-197915504 TTGTTTGAAAAGAACTGTTTGGG + Intronic
968677595 4:1892485-1892507 GTTTTTTAAAATAAGTGCTTAGG - Intronic
969389816 4:6883750-6883772 GTGTTTTTAAAGAAGTATAAGGG + Exonic
969638865 4:8384982-8385004 TTGTTTCCAAGGAAGTGTTCAGG + Intronic
969931921 4:10639068-10639090 GGGTCTTAAAAGATGTCTTCTGG - Intronic
970142847 4:13001312-13001334 GTGTATTAAAAGAATTATTTAGG - Intergenic
970889832 4:21030636-21030658 TTGTTTAACTAGAAGTGTTCAGG + Intronic
970893683 4:21076819-21076841 TTGCTTAAAAAGAAGTGTTGGGG + Intronic
971764863 4:30817848-30817870 GTGTTTTAAAAGAAGTGTTCTGG - Intronic
971973498 4:33652415-33652437 GTGTTTTAAAAGGATAGCTCTGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972248190 4:37268738-37268760 GTGTTTTAAGAAAATTATTCTGG + Intronic
974109337 4:57508849-57508871 GTGTTTTAATGGAAGTATTGAGG + Intergenic
974373608 4:61048446-61048468 GTGTTTTAAAAGTACTATACGGG + Intergenic
974439185 4:61895069-61895091 GAGTCTTAAAATAAGTGTGCAGG - Intronic
974641314 4:64634896-64634918 ATTTTTTACAAGAATTGTTCAGG - Intergenic
974715412 4:65663209-65663231 CTTTTTTAAAAGAGGTTTTCAGG + Intronic
974964500 4:68744648-68744670 CTGTTTTAAAAGAAGGTGTCAGG + Intergenic
976009143 4:80466438-80466460 TTGTTTTAAAAAAAGTTTTGAGG - Intronic
976332796 4:83851457-83851479 GTCTTTAAAAAGAAATGGTCAGG + Intergenic
976691098 4:87868005-87868027 GAGTTTTAAATAAAGTGTTGAGG - Intergenic
976803030 4:89014422-89014444 GTTTAATAACAGAAGTGTTCTGG + Intronic
977724660 4:100281763-100281785 CTGTTTTAAAAAGAGTGTTCTGG - Intergenic
978291279 4:107143968-107143990 TTGTTTTAAAAGAATAATTCAGG - Intronic
979346326 4:119591848-119591870 ATGTTTAAAAAGCTGTGTTCTGG + Intronic
979885492 4:126022922-126022944 GTGGTTTAATAGCAGTCTTCAGG + Intergenic
981087759 4:140701455-140701477 AAGTTTTAAAAGAAGCGTTAGGG - Intronic
981394056 4:144225518-144225540 TTTTTTTAAACAAAGTGTTCTGG - Intergenic
982582657 4:157198600-157198622 GTGTTTTTACAGAAGTATTTTGG + Intergenic
983827606 4:172283318-172283340 GTGCTTTAACTGAATTGTTCAGG + Intronic
984370909 4:178863508-178863530 CTGTTTTTACAGAAGTGTACAGG - Intergenic
985770702 5:1808367-1808389 GGATTTTAAAAGAAATCTTCTGG + Intronic
986771914 5:10981984-10982006 GTATGTAAAATGAAGTGTTCAGG - Intronic
988013653 5:25524960-25524982 GTGTTATAAAACAACTGTTAGGG + Intergenic
988308415 5:29525605-29525627 GTGTTTTCAAAGAAGTGTATGGG - Intergenic
988344163 5:30015493-30015515 GTTTTTCAAAAGAGGAGTTCTGG + Intergenic
988848622 5:35156394-35156416 ACGTTCTAAAAGAAGTATTCTGG - Intronic
989306921 5:39968682-39968704 ATGATTTAAAAGATGTGCTCTGG + Intergenic
989441183 5:41474116-41474138 CTGTTTTAAAGGAAGGGTCCAGG + Intronic
989441375 5:41475859-41475881 CTGTTTTAAAGGAAGGGTCCAGG + Intronic
990270309 5:54130320-54130342 GAGATTTAAAAAAAGTGTTCTGG + Intronic
990282437 5:54265788-54265810 GTGTTTTATAAAATGTGTTAAGG - Intronic
991260488 5:64662467-64662489 ATGTTTTAAAAGAATTACTCTGG - Intergenic
991471949 5:66978343-66978365 GTGTTTTAAAATCAGTCTTTAGG + Intronic
991976428 5:72187786-72187808 GTGTTTTTAAAGAAGCCTCCAGG - Intronic
992678434 5:79128996-79129018 ATATTTTAAAAGAAGGGTTTTGG + Intronic
993363775 5:87010306-87010328 GTGAATTAAAGGAAGTGTTCTGG + Intergenic
993466142 5:88249529-88249551 GAGTTTTAAAAAAAGTTTTTGGG - Intronic
993773922 5:91967055-91967077 GTTTTTTAAAAAAAATCTTCTGG - Intergenic
994341759 5:98637896-98637918 GTTTTTTAAAAGAAATACTCTGG - Intergenic
994382744 5:99090454-99090476 GTTTTTTAAAAGAAGTCATGAGG + Intergenic
994565191 5:101436144-101436166 GTGCATAAAAAGAAGTGTTTAGG - Intergenic
994939702 5:106306637-106306659 GTTTTTTTAAAGTAGTGTACTGG + Intergenic
995152202 5:108861865-108861887 TTGTTTTAAAATAAATGTTTAGG - Intronic
996200085 5:120661810-120661832 GTGTTTTAAAACAATGGTTGGGG - Intronic
997150964 5:131494690-131494712 GTGTTTTAAAAGCAATCTTTTGG + Intronic
997305473 5:132832660-132832682 GTGGGTTAATAGAATTGTTCTGG - Intergenic
998012364 5:138705503-138705525 GTCTTTTACAAGGAGTCTTCTGG - Intronic
999050450 5:148518564-148518586 ATGTTTTAAAAGAATCATTCTGG - Intronic
1000008599 5:157210781-157210803 GAGTTTTGAAAGATGTGTTGTGG + Intronic
1000951524 5:167489157-167489179 ATCTTTTAAAAGGATTGTTCTGG - Intronic
1001165467 5:169361630-169361652 GTTTCTTAAAACAAGTGTTTTGG + Intergenic
1001772875 5:174309045-174309067 GTGTTTGAAAGGAAGTGTTCAGG - Intergenic
1002531671 5:179850366-179850388 GTTTTTTAAGTGAAGTGTGCTGG + Intronic
1002759172 6:188617-188639 GTGTTAAAAAATAAGTGTTTAGG - Intergenic
1003479977 6:6521976-6521998 GTGTGTTAAAAGAACTGTGTGGG + Intergenic
1003480169 6:6524077-6524099 GTGTGTTAAAAGAACTGTGTGGG - Intergenic
1003761911 6:9188259-9188281 GTGTTTTAAAAGGAGTCCTCTGG + Intergenic
1004790320 6:19018882-19018904 GTGTTTTAAAATAACTATTCAGG + Intergenic
1004891666 6:20106873-20106895 GTGTTTTTAAAAAAATATTCTGG + Intronic
1004994632 6:21177572-21177594 GTTTTATAAATCAAGTGTTCTGG - Intronic
1005850843 6:29819665-29819687 CTGTTCTAAAAGAAGGGGTCGGG + Intergenic
1006029425 6:31168501-31168523 GTGTTTTAAAAGGTGTGGCCAGG - Intronic
1007344425 6:41217353-41217375 GTGTGTGAAAAGAAGAGTTGTGG + Intergenic
1007345919 6:41229323-41229345 GTGTGTGAAAAGAAGAGTTGTGG - Intronic
1007556159 6:42768261-42768283 CACTTTTAAAAGTAGTGTTCCGG - Intronic
1007811389 6:44488552-44488574 GAGTTTTAAAATAAGTGTCAAGG - Intergenic
1007879641 6:45149955-45149977 CTTTTTTAAAAAAATTGTTCAGG - Intronic
1008137166 6:47790211-47790233 CTGTTTTAAAAAAATTGTTTAGG - Intronic
1008690809 6:53976680-53976702 GTGTTTTAATAGCAGTTTTCTGG + Intronic
1008766626 6:54924909-54924931 ATGTTTTGAAAGGATTGTTCTGG - Intronic
1009173595 6:60431303-60431325 GAGTTTTTAAAAAATTGTTCAGG - Intergenic
1011613821 6:89179912-89179934 GTGTAATAAAAGAACTGTCCAGG - Intronic
1011671552 6:89688265-89688287 GTGTTTTAAAAGTAGAGAACTGG - Intronic
1014121600 6:117731861-117731883 GAGTTTTAAAATATTTGTTCAGG + Intergenic
1014578139 6:123099842-123099864 GTGTTCTAAAAGGATTGCTCTGG - Intergenic
1014693705 6:124593328-124593350 TTGTTTTAAAAAAAGTTTTTAGG - Intronic
1015006805 6:128292575-128292597 GAGTTGTGAAAGAAATGTTCTGG - Intronic
1016154592 6:140788987-140789009 GTGAGTTAATATAAGTGTTCTGG - Intergenic
1019176115 6:170160393-170160415 GTGTTTTGACAGAAGTTTTCAGG + Intergenic
1019875322 7:3805855-3805877 GGGTTTAAAGAGAAGTGTTTTGG - Intronic
1020555116 7:9661311-9661333 GGGTTTTAAAAGGAGGCTTCTGG - Intergenic
1020848444 7:13317656-13317678 GAATTTTAAAAGCAGTTTTCTGG - Intergenic
1021693486 7:23253148-23253170 GTTTTTTAAAGGAAGTCTCCTGG - Intronic
1022820926 7:33960279-33960301 CTGTTTTAAATGAAGTCTTAAGG + Intronic
1022823647 7:33986858-33986880 GTTTTTTAAATGAAGTTATCTGG - Intronic
1023271430 7:38467392-38467414 GTGTTTGCAGAGAAGTCTTCTGG + Intronic
1023294129 7:38697604-38697626 ATGTTTTAAAAGCAGTCTTTAGG + Intergenic
1024871765 7:53971679-53971701 GTATTTTAAAAGTAAGGTTCTGG + Intergenic
1026091367 7:67303068-67303090 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1026168128 7:67929135-67929157 GTATTTTAAAAGTATTGGTCGGG - Intergenic
1026363214 7:69622171-69622193 TTGTTTAAAAACAAGTGCTCTGG + Intronic
1026745056 7:73005404-73005426 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1027028446 7:74871347-74871369 TTTCTTTAAAAGAAGTGTACAGG - Intergenic
1027031168 7:74890099-74890121 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1027098684 7:75359676-75359698 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1027519789 7:79191581-79191603 TTATTTTAAAAGAAATGTTCAGG - Intronic
1028210657 7:88069999-88070021 TTTTTTTAAAAGAAATGTGCCGG + Intronic
1029399782 7:100336488-100336510 ATGTTTTAAAAGATTTATTCAGG + Intronic
1030312186 7:108080007-108080029 TTGATTTGAAAGCAGTGTTCCGG + Intronic
1030647845 7:112083665-112083687 GTCTTTTAAAAATTGTGTTCAGG - Intronic
1030746260 7:113170282-113170304 GAGTTTTAAAAGAATTCATCTGG - Intergenic
1031128685 7:117805732-117805754 GATTTTTAAAAAAATTGTTCAGG + Intronic
1033710180 7:143934790-143934812 GAGTTTTAAAAGAGATATTCTGG + Intergenic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1034756776 7:153629265-153629287 GTGTTTTAATGGAAGCCTTCAGG - Intergenic
1035989738 8:4476584-4476606 GTGTTTTACTAAAAGTGTTGTGG - Intronic
1036459995 8:8943901-8943923 GTCTTATAAAGGAAGTGTTCTGG + Intergenic
1036564946 8:9930651-9930673 ATCTTTTAAAAGAACTGGTCGGG + Intergenic
1036934082 8:12983902-12983924 GTTTTTTAAAAAAAGTGTTCAGG - Intronic
1038377481 8:27056865-27056887 GAGTTTAAAAAAAAGTTTTCAGG + Intergenic
1039654224 8:39381760-39381782 GTGTTTTAAAATGATTTTTCTGG + Intergenic
1040885235 8:52255511-52255533 GTGTTTTCAAAACAGTTTTCAGG - Intronic
1041354044 8:56981264-56981286 GTGTTTTAAAAATAATGTTTTGG + Intronic
1042589794 8:70386704-70386726 ATGATTTTAAAGAAGTCTTCTGG - Intronic
1042613411 8:70622562-70622584 AAGTTTTACCAGAAGTGTTCTGG - Intronic
1043300957 8:78731242-78731264 GTATTTTAAAACAGGTTTTCAGG - Intronic
1044457860 8:92409903-92409925 GTGTTCAAAAGGAAGTGTCCTGG + Intergenic
1045152952 8:99429785-99429807 GTGTTTTGAAAGAACTTCTCTGG - Intronic
1045495657 8:102706147-102706169 GATTTTTAAAAGATGTTTTCAGG + Intergenic
1046477829 8:114771221-114771243 GTGTTTTGGAAGAAGCGTTTTGG - Intergenic
1048064216 8:130950996-130951018 CTGATTTAAAAGAAATGTACTGG - Intronic
1049057042 8:140245097-140245119 GTTTTTTAAAAGAAGAGGCCAGG - Intronic
1049829964 8:144694160-144694182 GTGTTTTAAAGGAAATATTCTGG + Intergenic
1050364200 9:4859065-4859087 GTGTATTTAATGAACTGTTCAGG + Intronic
1050419505 9:5448775-5448797 GTTTTATGAAAGCAGTGTTCAGG - Intergenic
1050572838 9:6959149-6959171 TTCTTTTAAAAGTAGTGTTTGGG - Intronic
1051320322 9:15896877-15896899 GTTATTTATAAGAAGTTTTCTGG - Intronic
1051940644 9:22501602-22501624 GTTTTTTAAAAGAATTGATCTGG - Intergenic
1052347172 9:27421528-27421550 GTGTTTTAAAAGAACTACTCTGG - Intronic
1052555417 9:30008468-30008490 ATGTTTTAAAAGAGGACTTCGGG + Intergenic
1053224503 9:36341411-36341433 ATTTTTTAAATTAAGTGTTCCGG - Intronic
1055200443 9:73652727-73652749 GTCTTTTAAAACAGGTGTTTGGG - Intergenic
1055419490 9:76123583-76123605 TTGTTTTAAAAGAATTCTTCTGG - Intronic
1055660342 9:78496910-78496932 GTCTATTAAAAGAAGTATTCTGG - Intergenic
1055756530 9:79564306-79564328 GTGATTTACCAGAATTGTTCCGG + Intergenic
1055839239 9:80482731-80482753 CTGTTTTAAAGGAAGGGGTCAGG - Intergenic
1055994489 9:82142533-82142555 GTGTTCTAAAAGAAGTCTGTGGG - Intergenic
1057605415 9:96495132-96495154 GTTTTGTAAAGAAAGTGTTCAGG - Intronic
1058752951 9:108057159-108057181 GTTTTTAAAAGGCAGTGTTCAGG - Intergenic
1060963159 9:127695713-127695735 CTGTTTTAAAAGAAGGGGTCGGG - Intronic
1185690564 X:2151944-2151966 GTGTTTGTTAAGAAGTATTCTGG + Intergenic
1185948572 X:4404716-4404738 GTGTTTTAAAAAAATTATTCTGG - Intergenic
1186133859 X:6497833-6497855 GTTTTTCCAAAGAAGTTTTCAGG - Intergenic
1186341062 X:8646629-8646651 CTGTTTCAAAAGAAGATTTCTGG + Intronic
1186903914 X:14090550-14090572 GCAAATTAAAAGAAGTGTTCAGG + Intergenic
1187363074 X:18645692-18645714 GTGTTTTAAGAAAAGTTCTCTGG - Intronic
1187696979 X:21932698-21932720 GTGTTTTAAAAGAGCCATTCAGG + Intergenic
1188294249 X:28427585-28427607 GTGTTTTAAAAAAATTATCCAGG - Intergenic
1188408209 X:29838744-29838766 GTGTTTTAAAGCAAGTTTTAAGG - Intronic
1188568295 X:31551677-31551699 GAGTTTTAAAAGATGTGCTTTGG + Intronic
1188593304 X:31865439-31865461 ATTTTTTAAAAGTGGTGTTCGGG - Intronic
1188880920 X:35491012-35491034 GTGGTTTAAAAGATGTGATGAGG - Intergenic
1188965316 X:36544479-36544501 ATGTTTTATTAGAATTGTTCTGG + Intergenic
1189396249 X:40625282-40625304 CTGTTTTAAACTAAGTGTTGGGG - Intergenic
1189760502 X:44317063-44317085 CTGTTTTAAAGGAAGGGTCCGGG + Intronic
1190272964 X:48880915-48880937 ATGTTTTTAAATAAGTGTTTAGG - Intergenic
1191675859 X:63791767-63791789 GTGTTATCACAGAAGTGTTCCGG + Intergenic
1193737986 X:85183640-85183662 CTTTTTTAAAAGAAGTTTTGTGG + Intergenic
1193761954 X:85477824-85477846 ATGTTTTAAAAGATCTGTTTAGG - Intergenic
1193901870 X:87189465-87189487 GTGTTTTAAAGTAAGTATTAAGG + Intergenic
1194637723 X:96365967-96365989 GCATTTTTAAAGAAGTGTTTTGG - Intergenic
1195063944 X:101222035-101222057 CTGTTTTAAAATAAGTGTTGGGG + Intronic
1196385857 X:115149528-115149550 ATGTTTTAAAAGAATTGTCCAGG - Intronic
1196441582 X:115723910-115723932 TTTTTTTAAAAGAAGGGCTCTGG - Intergenic
1196445111 X:115841899-115841921 TTTTTTTAAAAGAAGGGCTCTGG - Intergenic
1196941253 X:120778241-120778263 GTGTGTTAAAACTATTGTTCCGG - Intergenic
1197325751 X:125091413-125091435 GTCTTTTAAAAGAAATGCTGAGG + Intergenic
1198084059 X:133266186-133266208 GCGTTTTAAAAGAGGCCTTCTGG - Intergenic
1198171157 X:134106411-134106433 CTGTTTTAAAAATATTGTTCTGG - Intergenic
1198453734 X:136794361-136794383 GTGTTTTAAAAGAATTACTCTGG - Intergenic
1198568545 X:137931429-137931451 ATGTTTTAAAAGAACAATTCTGG - Intergenic
1198873432 X:141199114-141199136 CTGTTTTAAAAGAAGGGGTCGGG + Intergenic
1198914120 X:141648051-141648073 GTGTTTTAAAGTGAGAGTTCTGG - Intronic
1200383829 X:155868733-155868755 CTGTTTTAAAGGAAGGGTCCAGG + Intergenic
1201617170 Y:15913468-15913490 GTTTTTCCAAAGAAGTTTTCGGG - Intergenic
1201754773 Y:17474928-17474950 CTGTTTTAAAAGAAGAGTCAGGG + Intergenic
1201799456 Y:17939191-17939213 CTGTTTTAAAAGAGGGGTTGAGG + Intergenic
1201802097 Y:17966765-17966787 CTGTTTTAAAAGAGGGGTTGAGG - Intergenic
1201846779 Y:18431057-18431079 CTGTTTTAAAAGAAGAGTCAGGG - Intergenic
1202362084 Y:24121420-24121442 CTGTTTTAAAAGAAGGGTCGGGG - Intergenic
1202362989 Y:24131676-24131698 CTGTTTTAAAAGAAGGGTCGGGG + Intergenic
1202507789 Y:25538440-25538462 CTGTTTTAAAAGAAGGGTCGGGG - Intergenic
1202508695 Y:25548694-25548716 CTGTTTTAAAAGAAGGGTCGGGG + Intergenic