ID: 971765568 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:30826437-30826459 |
| Sequence | CTGGAGACTCAGTTGGACCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3259 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 55, 4: 3201} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 971765568_971765571 | 6 | Left | 971765568 | 4:30826437-30826459 | CCTCGGTCCAACTGAGTCTCCAG | 0: 1 1: 0 2: 2 3: 55 4: 3201 |
||
| Right | 971765571 | 4:30826466-30826488 | TAGTATATTAGAAGCCATTCTGG | 0: 1 1: 0 2: 0 3: 12 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 971765568 | Original CRISPR | CTGGAGACTCAGTTGGACCG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||