ID: 971765568

View in Genome Browser
Species Human (GRCh38)
Location 4:30826437-30826459
Sequence CTGGAGACTCAGTTGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3259
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 3201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971765568_971765571 6 Left 971765568 4:30826437-30826459 CCTCGGTCCAACTGAGTCTCCAG 0: 1
1: 0
2: 2
3: 55
4: 3201
Right 971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971765568 Original CRISPR CTGGAGACTCAGTTGGACCG AGG (reversed) Intronic
Too many off-targets to display for this crispr