ID: 971765571

View in Genome Browser
Species Human (GRCh38)
Location 4:30826466-30826488
Sequence TAGTATATTAGAAGCCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971765566_971765571 10 Left 971765566 4:30826433-30826455 CCACCCTCGGTCCAACTGAGTCT 0: 1
1: 0
2: 2
3: 8
4: 193
Right 971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 115
971765568_971765571 6 Left 971765568 4:30826437-30826459 CCTCGGTCCAACTGAGTCTCCAG 0: 1
1: 0
2: 2
3: 55
4: 3201
Right 971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 115
971765567_971765571 7 Left 971765567 4:30826436-30826458 CCCTCGGTCCAACTGAGTCTCCA 0: 1
1: 0
2: 0
3: 3
4: 126
Right 971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 115
971765569_971765571 -1 Left 971765569 4:30826444-30826466 CCAACTGAGTCTCCAGCATATCT 0: 1
1: 0
2: 0
3: 15
4: 206
Right 971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971765571 Original CRISPR TAGTATATTAGAAGCCATTC TGG Intronic
907699151 1:56766344-56766366 TAGTATTTTACAAACCATTTAGG + Intronic
908499011 1:64724174-64724196 TTGAATATTAGGAGCCATGCAGG - Intergenic
908711236 1:67017930-67017952 TTATATATTAAAAGCCATTTGGG - Intronic
911683789 1:100749652-100749674 TACTATATTAGAAGAATTTCTGG - Intergenic
912831589 1:112957678-112957700 CAGTATATTAGAAGACAGTGTGG + Intergenic
917058948 1:171016177-171016199 CAGTATATTAATAGCCATCCTGG + Exonic
921223065 1:212987797-212987819 TCGTATATTGGAAGTCATTTAGG + Intronic
921971848 1:221158218-221158240 TATGATATAAGAAGCCATTGTGG - Intergenic
923250017 1:232171489-232171511 CATTATATTAGAAGCCCTTGGGG + Intergenic
1063893981 10:10659821-10659843 AAGTCTCTTTGAAGCCATTCTGG - Intergenic
1065555631 10:26912752-26912774 TTTTATTTTAGAAGCCATTGAGG - Intergenic
1068899640 10:62253064-62253086 TTTTATATTACAAGCCAATCTGG - Intronic
1069376813 10:67801244-67801266 TAATATATAAGAAGCCACTCAGG + Intronic
1070240009 10:74670562-74670584 TAGTATATTCATAGCCCTTCAGG + Intronic
1086225569 11:84504372-84504394 TGGCTTATTAGAACCCATTCTGG + Intronic
1086908728 11:92447785-92447807 TTGGATAAAAGAAGCCATTCTGG - Intronic
1092037133 12:5346013-5346035 GAGTAGATTAAAAGCCATTCTGG + Intergenic
1094325280 12:29231267-29231289 CAGAAGATTAGAAGCTATTCAGG + Intronic
1095507745 12:42915402-42915424 CAGTATTTTAGAAGACAATCTGG - Intergenic
1096427702 12:51518083-51518105 TAATATATAACAAGCCAATCAGG + Intergenic
1097489420 12:60246914-60246936 TAGTCTATTAGAAGCTACTCGGG + Intergenic
1098071293 12:66678148-66678170 TATTTTATTTGAAACCATTCTGG - Intronic
1098647740 12:72925392-72925414 TAGTATATTAGCTATCATTCAGG - Intergenic
1099742504 12:86658916-86658938 CAGAATATTAGAAGGCATCCTGG - Intronic
1100139018 12:91593205-91593227 TAGTAGAATAGAAGCAATACAGG + Intergenic
1100851217 12:98713580-98713602 TAGTATAATAAAAGGCATTTTGG + Intronic
1105291162 13:19054585-19054607 TAGTATTTTAAAAGAAATTCTGG - Intergenic
1109679442 13:65730640-65730662 ATCTATCTTAGAAGCCATTCCGG + Intergenic
1110357522 13:74585036-74585058 TAGTATAGTAGAATTCACTCAGG + Intergenic
1114064133 14:19046053-19046075 TACTTTATTAGCAGGCATTCGGG + Intergenic
1114098126 14:19353943-19353965 TACTTTATTAGCAGGCATTCGGG - Intergenic
1114717893 14:24846956-24846978 TAGTATATGAGAAACTATACAGG - Intronic
1114794472 14:25697115-25697137 TAATATATTTGAATTCATTCTGG - Intergenic
1119644054 14:76335922-76335944 TTGAATAATAGAAGCTATTCTGG - Intronic
1121592596 14:95128132-95128154 TAGGATATTATGTGCCATTCTGG - Intronic
1122659060 14:103282254-103282276 TAGTAGATGGGAAGCCATGCCGG + Intergenic
1123507900 15:20963760-20963782 TACTATTGCAGAAGCCATTCAGG - Intergenic
1123565119 15:21537502-21537524 TACTATTGCAGAAGCCATTCAGG - Intergenic
1123601381 15:21974789-21974811 TACTATTGCAGAAGCCATTCAGG - Intergenic
1131526756 15:93158909-93158931 TGGTATATTCGAGGCCATACAGG - Intergenic
1202973489 15_KI270727v1_random:264608-264630 TACTATTGCAGAAGCCATTCAGG - Intergenic
1134470247 16:14518521-14518543 TTTTATTTTACAAGCCATTCAGG - Intronic
1138908690 16:61369557-61369579 TCATATATGAGAAGCGATTCAGG - Intergenic
1139913758 16:70415458-70415480 TAATATATTGCAAGCCAGTCAGG + Intronic
1154360007 18:13652932-13652954 TATTCTACTAGAAGCAATTCTGG + Intergenic
1155791536 18:29977027-29977049 TAGTATATTAATAGGCATTCAGG + Intergenic
1157732031 18:50012164-50012186 TAGAATATTAGAAGCACTTGTGG - Intronic
925454488 2:4003451-4003473 TAGTATATTTGAAGTCCTTGAGG - Intergenic
930458461 2:51637811-51637833 TTGAATCTTAGAAACCATTCAGG + Intergenic
930717134 2:54603725-54603747 TAGCATATTAGAAGAAATTTTGG + Intronic
932061617 2:68506250-68506272 TATTAGATTAGAAGCCATGAGGG + Intronic
933400064 2:81784717-81784739 TTGTAAATTAGAAACCATTCAGG - Intergenic
934126043 2:88891516-88891538 TATTATATTATAAGACATTAAGG - Intergenic
936263811 2:110984289-110984311 TAGTATATTATAATATATTCAGG + Intronic
938510677 2:131939494-131939516 TAGAATATTAGAAGACGTTTGGG - Intergenic
938983385 2:136548103-136548125 TAATATAAAAGAAGGCATTCTGG - Intergenic
940750324 2:157619992-157620014 TAGTTGAGTAAAAGCCATTCTGG + Intronic
943877008 2:193080326-193080348 TAGTAAATTAGAAGCAAAACTGG + Intergenic
947279677 2:228436627-228436649 TCCTGTATTAGAATCCATTCCGG - Intergenic
1169837626 20:9898132-9898154 TGATATCTTGGAAGCCATTCAGG + Intergenic
1177622818 21:23618935-23618957 CAGTATATGAGACACCATTCAGG + Intergenic
1179088322 21:38240322-38240344 GATTATATTTGAAGCCACTCTGG + Intronic
1180482625 22:15768687-15768709 TACTTTATTAGCAGGCATTCGGG + Intergenic
949568395 3:5266916-5266938 TAATATATGAAAATCCATTCCGG - Intergenic
952693674 3:36240117-36240139 TAGTATCTTTGAATCCTTTCTGG - Intergenic
954445252 3:50542888-50542910 TAGTATAGTAGAGGCCAGACAGG - Intergenic
955001523 3:54931739-54931761 TAACATATTAGAAAACATTCTGG - Intronic
956354429 3:68375828-68375850 TTGTATATTAGAAGCCTCTGTGG - Intronic
961552284 3:127676310-127676332 TAGTACACGGGAAGCCATTCCGG + Exonic
963102681 3:141621916-141621938 TAGGATATTAGGAGCCATGCTGG + Intergenic
964598479 3:158466759-158466781 TAGTATTTTAAAAGCACTTCAGG + Intronic
968027464 3:195454472-195454494 AACTATATTAAAAGTCATTCTGG + Intergenic
970394060 4:15647528-15647550 TAATATATTAAAAGACATACAGG + Intronic
970863264 4:20729122-20729144 ATTTATATTACAAGCCATTCAGG - Intronic
971765571 4:30826466-30826488 TAGTATATTAGAAGCCATTCTGG + Intronic
973726797 4:53785052-53785074 TAGTATAATAGAAACCATGAAGG + Intronic
974188925 4:58477391-58477413 TAAAATATTAGAAGTGATTCAGG - Intergenic
974783056 4:66579606-66579628 TAGTTTATTAGATACTATTCGGG - Intergenic
978628907 4:110719923-110719945 TAATGTATTAAAAGCCAGTCCGG - Intergenic
980216892 4:129863600-129863622 TAGTGTGTTTGAAGGCATTCTGG + Intergenic
980994569 4:139767925-139767947 TAGAATATAATATGCCATTCTGG - Intronic
990312561 5:54553729-54553751 CAGTAGATTAGCAGCCATCCTGG + Intergenic
991197462 5:63953073-63953095 TAGTATATCAGATGGCAATCTGG - Intergenic
993408119 5:87537870-87537892 TAGTATTCGAGAAGCCATTAAGG - Intergenic
993907967 5:93644353-93644375 TGGAATTTTAGAAGCCATTTTGG + Intronic
995364996 5:111348715-111348737 TAGTATATTATTATTCATTCTGG + Intronic
996049525 5:118916363-118916385 TAGTCTATTAAAAGACATTAAGG + Intronic
997332621 5:133077018-133077040 TTAAAAATTAGAAGCCATTCAGG + Intronic
997716342 5:136045947-136045969 TATTCTAATAGAAGCCATTAGGG + Intronic
1001465819 5:171965228-171965250 TAAGATATTAGAACCCATCCAGG + Intronic
1001466224 5:171968883-171968905 TGGTATATTAGAGGACAATCAGG - Intronic
1002152136 5:177242827-177242849 TAGCATAGTAAAGGCCATTCTGG - Intronic
1004399400 6:15274585-15274607 TGCTATATAAGAAGCCACTCTGG - Intronic
1007457327 6:41989328-41989350 TGGTATATTAAAAGCTACTCGGG + Intronic
1011049763 6:83132055-83132077 TAGAATATTAAAAGCCTTTCAGG + Intronic
1012242890 6:96894276-96894298 TAGTCACTTAGTAGCCATTCTGG + Intronic
1013811095 6:114045392-114045414 TAGTATATTACAAGGCATAAAGG + Intergenic
1015419578 6:132990663-132990685 TAGTATTTTAAAAGATATTCTGG - Intergenic
1016082632 6:139874656-139874678 CACAATATTAGAAGCCTTTCTGG + Intergenic
1016301525 6:142636980-142637002 ATGTACATTAGAGGCCATTCTGG - Intergenic
1019941277 7:4293386-4293408 TTTTATATTTGTAGCCATTCTGG - Intergenic
1020943198 7:14565845-14565867 TACTATATTAAAAATCATTCTGG - Intronic
1023095879 7:36659350-36659372 GAGGGTATTAGAATCCATTCTGG - Intronic
1025183054 7:56833677-56833699 TAGCATATTAGAGTCCAATCAGG + Intergenic
1025688874 7:63743297-63743319 TAGCATATTAGAGTCCAATCAGG - Intergenic
1025908556 7:65809209-65809231 TAGCATATTAGAGTCCAATCAGG - Intergenic
1027980432 7:85213034-85213056 AAGTATATTAGAATACATTTAGG + Intergenic
1031491108 7:122389741-122389763 TAGTATATGTGAAGCAATTGTGG - Intronic
1031793104 7:126135230-126135252 TTGTATATTAGAATCCTTTCTGG + Intergenic
1031880901 7:127197222-127197244 AAGTAGATTAGAAGCCCTTTTGG - Intronic
1032022996 7:128420506-128420528 TAGTCACTTAGAAGCCATCCCGG + Intergenic
1041400666 8:57440977-57440999 TAATATATCAGATGCCTTTCAGG + Intergenic
1042479848 8:69290866-69290888 TATTATTTCAGATGCCATTCTGG - Intergenic
1043305221 8:78785656-78785678 TAGAATATAAGCATCCATTCTGG - Intronic
1044422184 8:92009772-92009794 TATTATAGTATAAGCCATTTTGG + Intronic
1045692477 8:104774079-104774101 TAATACATTAGAAGATATTCAGG - Intronic
1045834046 8:106499264-106499286 TAGTAATTTAGCAGTCATTCTGG - Intronic
1047822847 8:128540380-128540402 CAATAAATGAGAAGCCATTCTGG + Intergenic
1049764822 8:144350080-144350102 GAGTCCATTAGAAGCCATGCAGG + Intergenic
1058816312 9:108685753-108685775 AAGTATCTCAGATGCCATTCAGG + Intergenic
1060951128 9:127603925-127603947 TAGTTTATTAAAAGCTACTCTGG - Intergenic
1186019826 X:5241794-5241816 GACTAAATTAGAAGGCATTCAGG - Intergenic
1198498930 X:137223319-137223341 TTGTCTATGAGAAACCATTCTGG + Intergenic
1198887927 X:141359661-141359683 CAGTAGATTAGAGGCCTTTCTGG - Intergenic
1200180285 X:154146015-154146037 TAGGATATTTGAAGCTATTCAGG - Intronic
1200186113 X:154184410-154184432 TAGGATATTTGAAGCTATTCAGG - Intergenic
1200191765 X:154221548-154221570 TAGGATATTTGAAGCTATTCAGG - Intronic
1200197520 X:154259352-154259374 TAGGATATTTGAAGCTATTCAGG - Intronic