ID: 971766106

View in Genome Browser
Species Human (GRCh38)
Location 4:30834103-30834125
Sequence AACATATAACACCATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971766106 Original CRISPR AACATATAACACCATGTGCC AGG Intronic
903469558 1:23576408-23576430 TTCATGTAACACTATGTGCCAGG + Intergenic
908657297 1:66401830-66401852 AACACATAGCAACTTGTGCCTGG - Intergenic
908866549 1:68554771-68554793 AACAGCTTGCACCATGTGCCTGG + Intergenic
909229067 1:73062254-73062276 AACAGCTTGCACCATGTGCCTGG + Intergenic
909808777 1:79905547-79905569 AACAGTTTGCACCATGTGCCTGG - Intergenic
911276521 1:95866531-95866553 TGCAAATAACACTATGTGCCAGG + Intergenic
911686224 1:100780503-100780525 AACAGCTTACACCATGTGCCTGG - Intergenic
913402803 1:118454946-118454968 AACAGCTTGCACCATGTGCCTGG - Intergenic
914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG + Intronic
917401865 1:174658578-174658600 AAGCTCTAACACCCTGTGCCAGG + Intronic
917850108 1:179055144-179055166 AACCTATAACTCATTGTGCCTGG + Intronic
919101024 1:193097945-193097967 AAGATATAACAAAAAGTGCCTGG + Intronic
921929538 1:220743830-220743852 AACACATAAAACCAAGTGGCAGG - Intergenic
924845194 1:247761043-247761065 AAAATATAATACCTTGTGCAAGG - Intergenic
924898282 1:248366728-248366750 AACATGTAACATAATGGGCCTGG + Intergenic
1063014415 10:2061485-2061507 TACACATAACAACATGTGCCAGG + Intergenic
1063094617 10:2898719-2898741 GAAATATAACAGCATGTGCATGG + Intergenic
1063299082 10:4835607-4835629 AACAAAAAAAACCATGTGTCAGG - Intronic
1065584520 10:27204830-27204852 AACATATGAAACCATGGGCCGGG + Intronic
1066058643 10:31703538-31703560 AACAGCTTGCACCATGTGCCTGG + Intergenic
1066557940 10:36636042-36636064 AAAAAATAATACCATGGGCCAGG - Intergenic
1066747108 10:38611640-38611662 AACATTGAAAACCTTGTGCCAGG + Intergenic
1071035432 10:81238890-81238912 AACAGATTGCACCATGTGCTTGG - Intergenic
1074622297 10:115138239-115138261 AACAGCTTGCACCATGTGCCTGG - Intronic
1077244267 11:1528551-1528573 GACATGTAACACCAAGTCCCAGG + Intergenic
1077426171 11:2479174-2479196 AACAGCTTGCACCATGTGCCTGG - Intronic
1078750160 11:14154109-14154131 AACAGCTTGCACCATGTGCCTGG - Intronic
1079072689 11:17361578-17361600 AAAATATAATACCATTGGCCAGG - Intronic
1079542673 11:21594432-21594454 AACAGCTTGCACCATGTGCCCGG + Intergenic
1080373702 11:31682613-31682635 AAGAAATACTACCATGTGCCGGG + Intronic
1083554495 11:63614718-63614740 AAAATATACCACCAAGGGCCGGG + Intronic
1084367726 11:68713795-68713817 AACTCAACACACCATGTGCCAGG + Intronic
1086989429 11:93287034-93287056 AACATATAATTCCTTCTGCCTGG + Intergenic
1086991930 11:93313279-93313301 AACAGTTTGCACCATGTGCCTGG - Intergenic
1087461070 11:98448381-98448403 AACATAACACAGGATGTGCCGGG - Intergenic
1087511553 11:99101785-99101807 AACACCTCACACCATGTGCCTGG - Intronic
1089665688 11:120017138-120017160 AACTGATAATACCATGTGCCAGG + Intergenic
1091057819 11:132435439-132435461 AACATTTCACACCATGGGCCAGG - Intronic
1092652268 12:10647173-10647195 AACAGCTTGCACCATGTGCCTGG + Intronic
1093570561 12:20661945-20661967 AACAGCTGGCACCATGTGCCTGG + Intronic
1093753742 12:22830005-22830027 AACAGCTTGCACCATGTGCCTGG + Intergenic
1094738357 12:33260291-33260313 AACAGCTTGCACCATGTGCCTGG + Intergenic
1097142014 12:56909724-56909746 AACAGCTTGCACCATGTGCCTGG + Intergenic
1097522749 12:60689228-60689250 GACAGCTAGCACCATGTGCCTGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1099672858 12:85717438-85717460 AACAGCTTGCACCATGTGCCAGG - Intergenic
1100028795 12:90161623-90161645 AACAGTTTGCACCATGTGCCTGG - Intergenic
1100858462 12:98778990-98779012 AATGTATGACAACATGTGCCTGG - Intronic
1101958532 12:109231094-109231116 GACCTAAAGCACCATGTGCCTGG - Intronic
1102806595 12:115786827-115786849 CACATATGATACCATGTGCCAGG + Intergenic
1103358067 12:120336422-120336444 GACAGCTCACACCATGTGCCTGG - Intergenic
1104844795 12:131841347-131841369 CACAGATAACACCTTGTGCCTGG - Intronic
1105699483 13:22925804-22925826 TACATATAACACCATGTCCCGGG - Intergenic
1105851188 13:24338344-24338366 TACATATAACACCATGTCCCGGG - Intergenic
1107209650 13:37837329-37837351 AACAGCTTGCACCATGTGCCTGG + Intronic
1107343907 13:39439056-39439078 AACAGCTTGCACCATGTGCCTGG + Intronic
1109337210 13:61008316-61008338 AACAGCTTGCACCATGTGCCTGG + Intergenic
1110341914 13:74402321-74402343 AACAGCTTGCACCATGTGCCTGG - Intergenic
1110507281 13:76301665-76301687 AATATATGGCACCATGTTCCAGG + Intergenic
1111615102 13:90652640-90652662 AACAGCTTGCACCATGTGCCTGG + Intergenic
1113087814 13:106586053-106586075 GACAGATCGCACCATGTGCCTGG + Intergenic
1113353945 13:109559708-109559730 GACATGCACCACCATGTGCCTGG + Intergenic
1114984340 14:28208310-28208332 AACATATCACACCATTTGCAAGG - Intergenic
1118046468 14:61976278-61976300 AACAGCTTGCACCATGTGCCTGG - Intergenic
1118083390 14:62387640-62387662 AACAGCTTGCACCATGTGCCTGG + Intergenic
1120413828 14:84194174-84194196 AACAGCTTGCACCATGTGCCTGG + Intergenic
1120901785 14:89581639-89581661 AACATCAAACACCATGGCCCTGG - Intronic
1121611570 14:95284451-95284473 GACAGCTTACACCATGTGCCTGG + Intronic
1121811386 14:96894188-96894210 AACAGAGAGCACCGTGTGCCTGG + Intronic
1122765447 14:104066376-104066398 AACAGTTTGCACCATGTGCCTGG - Intergenic
1122840560 14:104460780-104460802 TACATTTAACACGATGTCCCGGG - Intergenic
1125425459 15:39544037-39544059 AACATTAACCACCATCTGCCTGG - Intergenic
1126273035 15:46844636-46844658 AACAGCTTGCACCATGTGCCTGG - Intergenic
1126815300 15:52448076-52448098 GACAGCTTACACCATGTGCCTGG + Intronic
1126873188 15:53011149-53011171 AACAGCTTGCACCATGTGCCTGG - Intergenic
1127682698 15:61312917-61312939 TGCATATCAAACCATGTGCCAGG - Intergenic
1130144766 15:81265527-81265549 ACCACTTAACACCCTGTGCCAGG - Intronic
1130748678 15:86685569-86685591 GATATAGAATACCATGTGCCTGG + Intronic
1131421568 15:92310492-92310514 AACTCATAACAGCATGGGCCAGG + Intergenic
1131690449 15:94821527-94821549 AACATATTCCACCTTGTGACAGG + Intergenic
1133799129 16:9070609-9070631 AACAGATCAAACCATTTGCCTGG - Intergenic
1134248262 16:12555949-12555971 AACTTGTAACACCATCTGCGTGG + Intronic
1134478204 16:14594416-14594438 AACATAAAACATCAGGGGCCGGG + Intronic
1137829103 16:51526807-51526829 ATCATATTACAGCTTGTGCCGGG - Intergenic
1139472548 16:67185946-67185968 AACAATTGACACCATGTGCCAGG + Intronic
1143472091 17:7182015-7182037 AACAAATAATACCATGTACCAGG + Intergenic
1144892709 17:18503380-18503402 AACAAACAAGTCCATGTGCCAGG + Intergenic
1145126952 17:20309316-20309338 AACATATAAGACAATTTTCCTGG - Intronic
1145139505 17:20440907-20440929 AACAAACAAGTCCATGTGCCAGG - Intergenic
1145796389 17:27657823-27657845 AACAAACAAGTCCATGTGCCAGG + Intergenic
1145810828 17:27763103-27763125 AACAAACAAGTCCATGTGCCAGG + Intronic
1146976069 17:37113102-37113124 AGCATACATCTCCATGTGCCGGG + Exonic
1149999873 17:61427308-61427330 AACATATAACACAAAGATCCAGG + Intergenic
1151051505 17:70984006-70984028 AACAGTTTGCACCATGTGCCTGG - Intergenic
1151086588 17:71387786-71387808 AACAGCTTGCACCATGTGCCTGG - Intergenic
1151203371 17:72485731-72485753 ATCATATTCCACTATGTGCCAGG - Intergenic
1151773262 17:76178633-76178655 ATCACATAATACTATGTGCCAGG + Intronic
1152170926 17:78747674-78747696 AACATAGAAAACATTGTGCCAGG - Intronic
1153693060 18:7613087-7613109 CAGATATCACCCCATGTGCCTGG + Intronic
1154049806 18:10943260-10943282 AACAGCTTGCACCATGTGCCTGG + Intronic
1154221651 18:12460041-12460063 AACAAAAAACACCATGAGGCTGG + Intronic
1155764114 18:29605899-29605921 AACAGATTGAACCATGTGCCTGG + Intergenic
1155795833 18:30035431-30035453 AACAGCTTGCACCATGTGCCTGG + Intergenic
1155809010 18:30208239-30208261 AACAGCTTGCACCATGTGCCTGG - Intergenic
1156941030 18:42767176-42767198 AACATCTTGCACCGTGTGCCTGG + Intronic
1159128316 18:64250872-64250894 TACATATAACACAATGTAGCAGG + Intergenic
1159718019 18:71849519-71849541 GACAGCTTACACCATGTGCCTGG + Intergenic
1159731602 18:72034437-72034459 AACAGGTTGCACCATGTGCCTGG - Intergenic
1160398334 18:78588580-78588602 AACACATGACACCCAGTGCCTGG - Intergenic
1160489728 18:79326546-79326568 GACACTTAACACCATGTGCAGGG - Intronic
1162298736 19:9831448-9831470 AGCAAATAACATTATGTGCCAGG - Intergenic
1168373155 19:55853122-55853144 AACAGTTAACACCTTATGCCAGG - Intronic
1168589188 19:57618569-57618591 CAGATAAAACACCATGGGCCTGG - Intronic
925827719 2:7866289-7866311 ACTATATAGCACCATCTGCCAGG - Intergenic
927007649 2:18866728-18866750 AACAGCTTGCACCATGTGCCTGG + Intergenic
927409232 2:22805959-22805981 AACAACTTGCACCATGTGCCTGG - Intergenic
928609967 2:32983021-32983043 AACAGCTTGCACCATGTGCCTGG + Intronic
929227026 2:39521587-39521609 AACAGCTTGCACCATGTGCCTGG - Intergenic
929850879 2:45589328-45589350 AAAATAAAACAGCATGTGCCAGG + Intronic
930266021 2:49199897-49199919 TACATATAACACATTGTGTCAGG + Intergenic
931265877 2:60660125-60660147 ACCATAGACCACCACGTGCCAGG + Intergenic
933251351 2:80032838-80032860 AAGACATACCACCATGTGCTTGG + Intronic
935323003 2:101906809-101906831 AACAGCTTGCACCATGTGCCTGG - Intergenic
936096772 2:109536205-109536227 AACAGCTTGCACCATGTGCCTGG + Intergenic
940878067 2:158918413-158918435 AAAATATAGCAACATTTGCCAGG + Intergenic
941883135 2:170501759-170501781 AAAATATAAAACCATGTGCTAGG - Intronic
942387868 2:175461026-175461048 TACAGATAGCACCGTGTGCCTGG + Intergenic
942528116 2:176877933-176877955 AACATATATCTGCATGTTCCTGG + Intergenic
942950132 2:181712483-181712505 AACACTTGGCACCATGTGCCTGG + Intergenic
943208465 2:184931161-184931183 AACAGCTTATACCATGTGCCTGG - Intronic
943297903 2:186161277-186161299 GACAGCTTACACCATGTGCCTGG + Intergenic
943634469 2:190290284-190290306 AACTTTTAATACCATGTGCCAGG - Intronic
945324987 2:208471781-208471803 AACAACTTGCACCATGTGCCTGG + Intronic
947011468 2:225571218-225571240 AACAGCTTGCACCATGTGCCTGG - Intronic
948331009 2:237165432-237165454 AGCAAATAACATCCTGTGCCAGG - Intergenic
1173323383 20:42009911-42009933 AACAGCTTGCACCATGTGCCTGG - Intergenic
1173385454 20:42583074-42583096 AACATATATTTGCATGTGCCAGG - Intronic
1174157570 20:48526067-48526089 AACTGATAACACCATGTGTGTGG + Intergenic
1174232171 20:49054627-49054649 AACATCTAGCATCGTGTGCCTGG + Intronic
1175107052 20:56622938-56622960 AACATGTAACACAGTGGGCCGGG - Intergenic
1176704359 21:10100994-10101016 CACCAACAACACCATGTGCCTGG - Intergenic
1177236091 21:18391634-18391656 GACATCTCACACCGTGTGCCTGG - Intronic
1178144005 21:29717348-29717370 AACAGCTTGCACCATGTGCCTGG + Intronic
1178306169 21:31491929-31491951 AAAAGATAACACCATCTGACTGG + Intronic
1178385827 21:32149556-32149578 AAAATATGCTACCATGTGCCTGG - Intergenic
1178614706 21:34122033-34122055 CACAAATAAAACCATGAGCCTGG - Intronic
1178634900 21:34293728-34293750 AACATCTAGCACAATATGCCTGG + Intergenic
1179450225 21:41463497-41463519 AACAGCTTGCACCATGTGCCTGG + Intergenic
1183898407 22:40987410-40987432 AAAATATAAAAAAATGTGCCGGG + Intergenic
1184575309 22:45359488-45359510 AACATTTTACATCATGTGCGGGG - Intronic
951794056 3:26518114-26518136 AACAGCTTGCACCATGTGCCTGG + Intergenic
957424974 3:80025656-80025678 AACACAGAACACCATGACCCAGG + Intergenic
958442413 3:94172150-94172172 GACATATCTCACCATCTGCCTGG + Intergenic
958943028 3:100335361-100335383 AACATTTAAAGCAATGTGCCAGG - Intronic
959976765 3:112469665-112469687 TTTATATAACACCATGTGCCAGG - Intronic
960492425 3:118333506-118333528 AACAGATTGCACCATGTACCTGG + Intergenic
962479276 3:135784840-135784862 AACATCTAACATCATGTACATGG - Intergenic
964150473 3:153518468-153518490 AACAGCTTGCACCATGTGCCTGG - Intergenic
964190517 3:153995165-153995187 AACATAGATCACCATTTTCCTGG + Intergenic
967191211 3:186986339-186986361 AATATTCAACACTATGTGCCAGG - Intronic
967582785 3:191179440-191179462 AACAGCTTGCACCATGTGCCTGG + Intergenic
967935940 3:194727660-194727682 AACATATGACACAATATGCCTGG - Intergenic
970995063 4:22257998-22258020 AAAAGAGAACACCATGGGCCAGG + Intergenic
970997467 4:22283446-22283468 AACAGCTTGCACCATGTGCCTGG + Intergenic
971467744 4:26982585-26982607 AAGACATAACACAATGAGCCTGG - Intronic
971546317 4:27891359-27891381 AACAGCTCTCACCATGTGCCTGG + Intergenic
971766106 4:30834103-30834125 AACATATAACACCATGTGCCAGG + Intronic
972631309 4:40844251-40844273 ACCATGTAACACAGTGTGCCTGG - Intronic
972860306 4:43160522-43160544 TACATATAACACCATCTTCAGGG - Intergenic
973182991 4:47291525-47291547 AACAGCTTGCACCATGTGCCTGG + Intronic
975506966 4:75148560-75148582 GACAGATTGCACCATGTGCCTGG - Intergenic
976743784 4:88383415-88383437 TATATATAGTACCATGTGCCAGG + Intronic
976770725 4:88649561-88649583 AACCTATACAGCCATGTGCCTGG - Intronic
976949743 4:90813813-90813835 AACAGCTTGCACCATGTGCCTGG - Intronic
977655940 4:99520624-99520646 AACATATATTACCATGAGCATGG - Intronic
980038740 4:127914806-127914828 AAAATATATCACCTTGGGCCTGG + Intergenic
981234395 4:142398083-142398105 AACATATAACAGCCTGGGCGCGG + Intronic
981343377 4:143647927-143647949 AACAGCTTACACCGTGTGCCTGG + Intronic
982589605 4:157290064-157290086 TACATATAAAATTATGTGCCAGG - Intronic
983006434 4:162490665-162490687 AACAGCTTGCACCATGTGCCTGG + Intergenic
984355362 4:178652260-178652282 AAAATCTTGCACCATGTGCCTGG + Intergenic
985371768 4:189292589-189292611 AACAGCTCACACCATGAGCCTGG + Intergenic
986271957 5:6239956-6239978 AAAATAGAACACCATGAGCGAGG + Intergenic
986947985 5:13047768-13047790 AACAACTTGCACCATGTGCCTGG - Intergenic
987190996 5:15478256-15478278 AACAGCTTACACCATGTGCCTGG + Intergenic
987260350 5:16196243-16196265 GACATCTTGCACCATGTGCCTGG - Intergenic
987913227 5:24177610-24177632 CACATTTAACACCAGGTGACTGG + Intronic
988379638 5:30483378-30483400 AACATATTGCACCATGTGATAGG + Intergenic
989523596 5:42427949-42427971 GACAGTTAGCACCATGTGCCTGG - Intronic
989752277 5:44909652-44909674 TACAAATAAAACCATGTGCATGG + Intergenic
990041151 5:51380116-51380138 AACATATAGCATCATCTCCCTGG + Intergenic
990646499 5:57850377-57850399 AAGATATAACAGCATGTTGCAGG - Intergenic
991184815 5:63794720-63794742 AACAGCTTGCACCATGTGCCCGG - Intergenic
992375623 5:76185279-76185301 AACAGCTTGCACCATGTGCCTGG - Intronic
992889339 5:81189444-81189466 AACATAAAACACCATTTGCAAGG - Intronic
994338824 5:98601184-98601206 GACAGCTTACACCATGTGCCTGG + Intergenic
995187626 5:109289025-109289047 AAGATATGAAACCAAGTGCCTGG + Intergenic
996600129 5:125253390-125253412 GACAGCTTACACCATGTGCCTGG - Intergenic
996911428 5:128660904-128660926 AACAGCTTGCACCATGTGCCTGG + Intronic
998873427 5:146575544-146575566 AACAGCTTGCACCATGTGCCTGG - Intergenic
998945979 5:147339562-147339584 AACAGTTTGCACCATGTGCCTGG + Intronic
999304831 5:150512716-150512738 AGCTTATATTACCATGTGCCAGG + Intronic
999348159 5:150842726-150842748 ATCAGAGAACTCCATGTGCCCGG - Intergenic
1000575030 5:162966523-162966545 TACAGCTATCACCATGTGCCTGG - Intergenic
1000751344 5:165099662-165099684 GACAGCTTACACCATGTGCCTGG - Intergenic
1004017513 6:11745741-11745763 AACATATAACTACATGTGAGAGG + Intronic
1007110625 6:39311618-39311640 AACTGCTAACACCATGTGCCAGG - Intronic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1007984795 6:46197164-46197186 AACAGTTTGCACCATGTGCCTGG - Intergenic
1009945884 6:70341419-70341441 AACAACTTGCACCATGTGCCTGG - Intergenic
1012198523 6:96375727-96375749 AGCATTCAACACCATGTGCCAGG - Intergenic
1013086688 6:106863447-106863469 AACAGCTTGCACCATGTGCCTGG + Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1013876991 6:114843914-114843936 AAAATATAAAAACATGAGCCAGG + Intergenic
1015178658 6:130338500-130338522 AACAGCTTGCACCATGTGCCTGG + Intronic
1016122795 6:140364408-140364430 AACAGCTTGCACCATGTGCCTGG + Intergenic
1016176358 6:141081643-141081665 AACAGCTTGCACCATGTGCCTGG + Intergenic
1018178088 6:161196364-161196386 ATCAAATAACACCTAGTGCCTGG + Intronic
1018337052 6:162803893-162803915 AATATAAAACATCATATGCCTGG + Intronic
1018918065 6:168150159-168150181 AACATTTAACACCATGTCAAAGG - Intergenic
1021308192 7:19057697-19057719 AACATAAAGCAACATTTGCCTGG - Intronic
1021960400 7:25866277-25866299 AAAATTTAATACCATGGGCCGGG + Intergenic
1022492847 7:30834027-30834049 AACAGCTTGCACCATGTGCCTGG - Intronic
1024383486 7:48725241-48725263 AACAGCTTGCACCATGTGCCTGG - Intergenic
1025300332 7:57814908-57814930 AACATCTTGCACCATGAGCCTGG - Intergenic
1025625487 7:63217635-63217657 AAAACATAACACCATGAGCCAGG + Intergenic
1026145370 7:67741898-67741920 ACCATATCAGACCATATGCCTGG - Intergenic
1027359406 7:77392707-77392729 ACCATTTCACAGCATGTGCCTGG - Intronic
1028723477 7:94060507-94060529 AACATATAAAACAATGGGCCAGG + Intergenic
1029309950 7:99653802-99653824 CAAATATAACACCAAGTGCTAGG - Intronic
1030072730 7:105711741-105711763 AACATCTTGCACCATGCGCCTGG - Intronic
1030408959 7:109150497-109150519 TACATATAAGATCATGTGGCTGG + Intergenic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1031242625 7:119266115-119266137 AACAGCTTACACCATATGCCTGG - Intergenic
1031792029 7:126118377-126118399 AACAGCTTGCACCATGTGCCTGG + Intergenic
1031806781 7:126316841-126316863 AACAGCTTGCACCATGTGCCTGG - Intergenic
1032592794 7:133207581-133207603 AAAATATAACTCCATTTTCCAGG - Intergenic
1037148504 8:15604859-15604881 AACAAATAAAACCATTTTCCTGG - Intronic
1037310304 8:17548822-17548844 AAAATATATCAGCAAGTGCCAGG + Exonic
1039685716 8:39800059-39800081 ACCAAATAGCACCATGTGACAGG - Intronic
1041075022 8:54161392-54161414 AACAGCTTGCACCATGTGCCTGG + Intergenic
1041977576 8:63817354-63817376 AACAGCTTGCACCATGTGCCGGG - Intergenic
1043092970 8:75928225-75928247 AACAGCTTGCACCATGTGCCTGG - Intergenic
1044217804 8:89633558-89633580 AACATATAAAACAATATGCATGG - Intergenic
1045497861 8:102723408-102723430 AGCATATAAGACCCTATGCCTGG + Intergenic
1048240106 8:132732750-132732772 AAGATATTGCACCATGTCCCCGG - Intronic
1048551837 8:135440634-135440656 ATCATTGAGCACCATGTGCCTGG - Intergenic
1050392284 9:5157132-5157154 AATATATAATACCATGTTCATGG + Intronic
1050864350 9:10479198-10479220 ATCATGTAACAGAATGTGCCTGG - Intronic
1052208269 9:25869894-25869916 AACAGCTCGCACCATGTGCCTGG - Intergenic
1052626051 9:30978624-30978646 AACATCTTACACTGTGTGCCTGG + Intergenic
1052679185 9:31667253-31667275 AACTTTTAACACCATATACCTGG - Intergenic
1052740428 9:32387069-32387091 AACGTGTATCACCACGTGCCTGG + Intronic
1052869876 9:33494131-33494153 AAAATATAAAACCATGTCACCGG + Intergenic
1053641620 9:40088010-40088032 CACCAACAACACCATGTGCCTGG - Intergenic
1053764515 9:41377454-41377476 CACCAACAACACCATGTGCCTGG + Intergenic
1054267820 9:62937092-62937114 GACATTTTGCACCATGTGCCTGG + Intergenic
1054322508 9:63685399-63685421 CACCAACAACACCATGTGCCTGG - Intergenic
1054543131 9:66288631-66288653 CACCAACAACACCATGTGCCTGG + Intergenic
1055794112 9:79955553-79955575 AACAGCTTACACCGTGTGCCTGG + Intergenic
1056595199 9:88002221-88002243 AACAGTTGGCACCATGTGCCTGG + Intergenic
1056614990 9:88157612-88157634 AAAATATAACACCATCTGATGGG - Intergenic
1057688513 9:97260927-97260949 AAAATATAAAACCATGTCACTGG - Intergenic
1057900224 9:98942987-98943009 AAGATCTCACACTATGTGCCGGG + Intergenic
1058372342 9:104284442-104284464 TATATATACCACTATGTGCCAGG - Intergenic
1058713542 9:107702289-107702311 GAAACATAGCACCATGTGCCAGG + Intergenic
1058722022 9:107772995-107773017 AACAGCTTGCACCATGTGCCTGG - Intergenic
1202789396 9_KI270719v1_random:71096-71118 CACCAACAACACCATGTGCCTGG - Intergenic
1188836352 X:34960673-34960695 GACATATAACACCATGATGCAGG - Intergenic
1189998429 X:46661613-46661635 GCCACATAACACCATGTGGCCGG + Intronic
1191634983 X:63366455-63366477 AAAATATACCACAAAGTGCCAGG + Intergenic
1191982209 X:66938745-66938767 AACCTATAACACCATGTAAGAGG - Intergenic
1193996094 X:88367153-88367175 AACAGCTTGCACCATGTGCCTGG - Intergenic
1194274071 X:91857845-91857867 GACAACTTACACCATGTGCCTGG - Intronic
1194339772 X:92693947-92693969 AACAACTTGCACCATGTGCCTGG - Intergenic
1195126702 X:101815274-101815296 AACAGCTTGCACCATGTGCCTGG - Intergenic
1195816812 X:108896965-108896987 AACAGCTTTCACCATGTGCCTGG + Intergenic
1196540347 X:116900221-116900243 AACACCTTGCACCATGTGCCTGG - Intergenic
1197202369 X:123759367-123759389 AACAGCTTGCACCATGTGCCTGG + Intergenic
1198018599 X:132636043-132636065 AACATGTATCACAATGTGCTGGG + Intronic
1199193844 X:145003833-145003855 AACACATAAAACTATGTGCTTGG - Intergenic
1199349868 X:146787914-146787936 AACAGCTTACACCACGTGCCTGG + Intergenic
1199413379 X:147551896-147551918 AATATATAACACTGTGTGGCGGG + Intergenic
1199529267 X:148828779-148828801 AACATATATGACCATGTGCAGGG - Intronic
1200365069 X:155653947-155653969 AAATTATGACACCATCTGCCTGG + Intronic
1200490107 Y:3814008-3814030 AACAGCTTGCACCATGTGCCTGG - Intergenic
1200648156 Y:5810730-5810752 AACAACTTGCACCATGTGCCTGG - Intergenic
1200793462 Y:7319413-7319435 AACATAAGTCACCATGTGCAGGG - Intergenic
1201237696 Y:11927455-11927477 ATGATACAACACGATGTGCCTGG + Intergenic
1201485459 Y:14489423-14489445 AAAATATAACACAATTTGGCCGG + Intergenic