ID: 971766355

View in Genome Browser
Species Human (GRCh38)
Location 4:30836969-30836991
Sequence CTTGAGACACATATAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971766347_971766355 30 Left 971766347 4:30836916-30836938 CCGACTCACTTTAAACCGTACTG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG 0: 1
1: 0
2: 1
3: 25
4: 321
971766350_971766355 15 Left 971766350 4:30836931-30836953 CCGTACTGGCCAGCACAGTAGGA 0: 1
1: 0
2: 1
3: 17
4: 321
Right 971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG 0: 1
1: 0
2: 1
3: 25
4: 321
971766351_971766355 6 Left 971766351 4:30836940-30836962 CCAGCACAGTAGGACAGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG 0: 1
1: 0
2: 1
3: 25
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971766355 Original CRISPR CTTGAGACACATATAAAACA TGG Intronic
900072561 1:784310-784332 CTTAAGAGACATATCAGACATGG + Intergenic
906773482 1:48506618-48506640 ATTGTGAAACATATAAAACAGGG - Intergenic
906906675 1:49901915-49901937 CTTGACAAACATAAACAACAAGG + Intronic
907978575 1:59457943-59457965 TGTGAGAAATATATAAAACAAGG - Intronic
908952072 1:69572556-69572578 CCTGAGTCACATAAATAACATGG - Intronic
910054465 1:83015084-83015106 TTTGAGACAGGTATAAAAGAAGG - Intergenic
910385180 1:86674834-86674856 TGTGAGACAATTATAAAACACGG + Intergenic
911127267 1:94352207-94352229 CTGGGGACACATACATAACAAGG - Intergenic
911923397 1:103795508-103795530 AATGAGACACATATACACCATGG - Intergenic
912684379 1:111750323-111750345 CATGAGACACATGTAAAAATGGG + Intronic
913204326 1:116522493-116522515 ACAGAGACACACATAAAACAAGG + Intronic
913271437 1:117097549-117097571 CTATAGACACATACAAAGCAAGG - Intronic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916181542 1:162088310-162088332 CCTGAGGAACTTATAAAACATGG + Intronic
917036836 1:170757249-170757271 CTTGAGACTCATCTACAATATGG + Intergenic
917304111 1:173609166-173609188 TTTGGGAGACATTTAAAACAGGG + Intergenic
917388758 1:174508688-174508710 CGTGAGACACATCTAGACCAGGG + Intronic
918403166 1:184184795-184184817 CTGGAGGCACATATACACCATGG - Intergenic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
918855301 1:189747254-189747276 CTTGTGGCACATATATACCATGG + Intergenic
919019581 1:192087063-192087085 CTTCAGTCAAACATAAAACAAGG + Intergenic
920806387 1:209238074-209238096 CTGGAGAAAAATAGAAAACAAGG + Intergenic
920894587 1:210033130-210033152 CTTGAGGCAGATATTAATCATGG + Intronic
922268143 1:224007234-224007256 CTTAAGAGACATATCAGACATGG + Intergenic
922299344 1:224282902-224282924 CTAGAGATACATATAAAATTAGG - Intronic
923629715 1:235641871-235641893 CATGAGAGAAAAATAAAACAAGG - Intronic
1062998424 10:1890887-1890909 TTTGAGAAACATATAAAATGTGG - Intergenic
1064508983 10:16068231-16068253 CATGAGATAGATATAAAATATGG - Intergenic
1064962233 10:20977869-20977891 CTTGAGTTACAGATAAAACCGGG - Intronic
1065525620 10:26617356-26617378 CTTCTGACACAGATAAATCAAGG + Intergenic
1066752004 10:38667620-38667642 CATGTGACACATATACACCATGG + Intergenic
1067823962 10:49556200-49556222 TTTGAGACAAAAATAAAAAAAGG - Intergenic
1068016299 10:51520881-51520903 CTTTAGACATATATAAAATTAGG + Intronic
1068488414 10:57690034-57690056 CTTCAGTCACATGAAAAACAGGG + Intergenic
1068562856 10:58535825-58535847 CAGGAGACACATCTAACACAAGG + Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1071721011 10:88146075-88146097 CTTGAGAGAGAAATAAACCAAGG - Intergenic
1073036426 10:100567097-100567119 CTCAATACACATATAAAATAGGG + Intergenic
1073148496 10:101295844-101295866 CTTGTGACTCATTTGAAACATGG + Intergenic
1073690228 10:105799939-105799961 GTTGAGGCACATATACACCATGG + Intergenic
1073855449 10:107668001-107668023 CTTCAGACAAATATAATCCAAGG + Intergenic
1073871328 10:107868196-107868218 CTTGAGACACAGAGAAATTAAGG - Intergenic
1076736777 10:132462528-132462550 CTGGAGACCCAGGTAAAACAAGG - Intergenic
1077940463 11:6835206-6835228 CTTGTGGGCCATATAAAACAGGG - Intergenic
1078054615 11:7997600-7997622 CAGGAGACACATCTAAAACAAGG + Exonic
1078148295 11:8737371-8737393 CCTGAGACACTTAAGAAACAGGG + Intronic
1079754923 11:24245422-24245444 CTTGAGAAAAATATAATAAAAGG + Intergenic
1080174279 11:29343266-29343288 CTTGAGACAGAGAAAAAGCATGG - Intergenic
1080410530 11:32020029-32020051 CTTGTGGCACATATATAACATGG - Intronic
1081020344 11:37939666-37939688 CTTGTGAAACTTATAAAACTAGG - Intergenic
1081102335 11:39020432-39020454 CTTGAAACTCATATATACCAGGG - Intergenic
1082186373 11:49186794-49186816 TATGAGTCAGATATAAAACAAGG + Intronic
1083087476 11:60165159-60165181 ATTGTGGTACATATAAAACATGG + Intergenic
1083557589 11:63643893-63643915 CTAAAGACACATATAGAACTTGG + Intronic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085211322 11:74782021-74782043 CTTGCCACACATATAATAAAAGG - Intronic
1085437626 11:76522787-76522809 CTTCAGTCACATATAATACTGGG + Intronic
1085839813 11:79998979-79999001 AATGTGACACATATAAACCATGG + Intergenic
1086206802 11:84268168-84268190 CTTGAGACAGTTTTAAAACAGGG - Intronic
1086914892 11:92518297-92518319 CGTGTGACACATATACACCATGG + Intronic
1089457410 11:118633684-118633706 CCTGAGCCACCTATAACACAGGG + Intronic
1090775380 11:129960257-129960279 CTTTGGTCACACATAAAACATGG + Intronic
1091812384 12:3410213-3410235 CTTGAGAAACCTAAAAAACATGG - Intronic
1092104265 12:5910075-5910097 CTAGAGACACATCTAAAAATTGG + Intronic
1092155022 12:6276560-6276582 CTTGAGACACGTTCAACACACGG - Intergenic
1093573237 12:20693725-20693747 AGTGATACACCTATAAAACAAGG + Intergenic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1094273428 12:28642291-28642313 CTTGGGATAAACATAAAACAAGG + Intergenic
1094568220 12:31618949-31618971 CTTGAGACAGGAATAATACAGGG - Intergenic
1095676434 12:44924359-44924381 CTTTAGATATATATAAAAAATGG + Intergenic
1098076332 12:66735967-66735989 CTTGAGACACATATGAGATGTGG + Intronic
1098608821 12:72428977-72428999 TTTGTGACACATATACACCATGG + Intronic
1098970763 12:76853998-76854020 CTTTAGACATATTTAAAACTTGG - Intergenic
1100873790 12:98941131-98941153 ACAGAAACACATATAAAACAAGG - Intronic
1101584121 12:106069596-106069618 ACAGAGACACACATAAAACAAGG + Intronic
1104386119 12:128353108-128353130 CAAGAGACAAATATAAATCAAGG + Intronic
1106276757 13:28216424-28216446 CTTGACACAGATATACAACCTGG - Intronic
1106326054 13:28691253-28691275 TCTGAGACACATTTAAAGCAGGG - Intergenic
1106888713 13:34218990-34219012 CTTGAGACACAGACAGAAAATGG + Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1107704898 13:43092211-43092233 CATGAGAGATATTTAAAACAAGG - Intronic
1107792849 13:44019489-44019511 ACAGAAACACATATAAAACAAGG + Intergenic
1108619468 13:52167050-52167072 CTTTAGGTATATATAAAACAGGG - Intergenic
1110130760 13:72006590-72006612 CTTGAGACCCATAAGAAGCATGG + Intergenic
1111312111 13:86502485-86502507 TTTTAGAAATATATAAAACATGG - Intergenic
1111440191 13:88272439-88272461 ATACAGACACATTTAAAACAGGG + Intergenic
1111710886 13:91813177-91813199 TTTTTGACACATATAAAACAGGG + Intronic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114396632 14:22369231-22369253 CTTGAGACAAATTTAATATATGG - Intergenic
1114411598 14:22505941-22505963 TTTGAGACAGAAATAAGACAGGG + Intergenic
1114489589 14:23090803-23090825 CTTGAGTCACACACAAAAAAAGG + Intronic
1114706253 14:24729482-24729504 CCTGAGACACAGCTAAAGCAGGG + Intergenic
1115101328 14:29704272-29704294 CATGAGAAAAATATAAAATAAGG + Intronic
1117435659 14:55713166-55713188 CTTTAGACACACACAAAGCAAGG + Intergenic
1117807129 14:59506137-59506159 TTTTAGACAAATATATAACAAGG - Intronic
1118047713 14:61989749-61989771 CTTTAGAATCATACAAAACAAGG - Intergenic
1118138201 14:63050697-63050719 CTTGATACATATAGAAATCACGG - Intronic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1119017949 14:71079207-71079229 AATGTGACACATATACAACATGG - Intronic
1120376380 14:83712861-83712883 CTTGGGAAAGATATCAAACAGGG - Intergenic
1121105467 14:91276429-91276451 CACGAGAGAAATATAAAACATGG - Intronic
1121255876 14:92529932-92529954 ACAGAGACACACATAAAACAAGG + Intronic
1121843990 14:97157309-97157331 CTGGGGAAAAATATAAAACAGGG + Intergenic
1123604008 15:22005276-22005298 CTTGTGGCACATATACACCATGG + Intergenic
1124986174 15:34617982-34618004 TTTTTGACAAATATAAAACAGGG + Intergenic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1126381191 15:48049045-48049067 CTTGAGAGTCATATCAAATAGGG - Intergenic
1126872427 15:53004020-53004042 CTTGATACACATAAACAAAATGG + Intergenic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1129481955 15:75833605-75833627 CTTGACACACAAAGAAACCAAGG + Intergenic
1133551588 16:6861144-6861166 CATGAGACATATAAAAAATACGG - Intronic
1136730722 16:32409476-32409498 CATGTGACACATATACACCATGG - Intergenic
1137384531 16:48029298-48029320 TCTGAGACACATGTAAAAGAGGG + Intergenic
1137544584 16:49392414-49392436 CTAGATACACATTTAAAACCAGG + Intronic
1139048348 16:63091074-63091096 CCTTAGACACACAAAAAACATGG + Intergenic
1139127417 16:64095879-64095901 CTTGAGACAAATTAAGAACATGG + Intergenic
1202995675 16_KI270728v1_random:107793-107815 CATGTGACACATATACACCATGG + Intergenic
1203022362 16_KI270728v1_random:420135-420157 CATGTGACACATATACACCATGG + Intergenic
1143071372 17:4296875-4296897 GTTAAAACAAATATAAAACAAGG + Intronic
1146338723 17:32000030-32000052 CGTGAAACACATATAACACAGGG - Exonic
1149725546 17:58890158-58890180 GCAGAAACACATATAAAACAAGG - Intronic
1149768852 17:59303961-59303983 CTTGAGCCACATATACACAATGG + Intergenic
1151460793 17:74252942-74252964 CTTGAGACTCCTCTAAAACGCGG - Intronic
1151588673 17:75028520-75028542 CTTGGGCCACATGTCAAACAGGG + Intergenic
1151783339 17:76262252-76262274 CTTGAATCACAAATAAAACATGG - Intergenic
1153068450 18:1076626-1076648 ATGGAGACACATATTAACCATGG + Intergenic
1153828300 18:8897399-8897421 CAGGAGACACATCTAAGACACGG - Intergenic
1154260925 18:12832075-12832097 CTTCAGACCCACATACAACAAGG + Intronic
1156761324 18:40594751-40594773 TTTGAGAAAAATATAAAACATGG + Intergenic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158766844 18:60460986-60461008 CTTGAAATACAAAGAAAACAGGG + Intergenic
1158817221 18:61116361-61116383 TTAGAAACACATAGAAAACAAGG + Intergenic
1160020664 18:75178237-75178259 GCAGAAACACATATAAAACAAGG + Intergenic
1160192931 18:76730067-76730089 CTTGAAACAAATAAAAAAGAAGG - Intergenic
1164176732 19:22782237-22782259 CTTGAGATACCTGTAAAAAATGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168382311 19:55934200-55934222 ACAGAGACACATATAAAACAAGG - Intergenic
925780965 2:7381514-7381536 CTAGAGTCACATATAAGACAGGG + Intergenic
926930465 2:18033656-18033678 TTTGACAAACATATAAAACATGG + Intronic
927727786 2:25440788-25440810 CTTGAGAGAGAAATAAAATATGG - Intronic
930247213 2:48996456-48996478 ATAGAAACATATATAAAACATGG - Intronic
930358644 2:50350150-50350172 ATTCAGAAACACATAAAACAAGG - Intronic
930697246 2:54424519-54424541 CTTGAGACACATATCCCACAGGG + Intergenic
930917470 2:56711131-56711153 CTTGAGACACAAATAAAAAGGGG + Intergenic
931157862 2:59655714-59655736 CTTGATAACCTTATAAAACATGG + Intergenic
931933019 2:67162140-67162162 CTTGTGGCACATATACACCATGG + Intergenic
932079303 2:68697129-68697151 ATAGAAACATATATAAAACAAGG - Intronic
934314997 2:91909773-91909795 CATGTGACACATATACACCATGG + Intergenic
934991602 2:98925365-98925387 CTTGAGACAGGTTAAAAACAAGG + Intronic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
935474251 2:103498890-103498912 TGTATGACACATATAAAACATGG + Intergenic
935901351 2:107797088-107797110 CATGAGAGTCAAATAAAACAGGG + Intergenic
936583870 2:113733984-113734006 GATGACACAAATATAAAACAAGG + Intronic
937068579 2:119042249-119042271 TATGGGATACATATAAAACATGG + Intergenic
939008261 2:136814851-136814873 CTTGAGACCCATACAAAAACAGG - Intronic
939047334 2:137265185-137265207 CTTGTGGCACATATACACCATGG - Intronic
940135513 2:150431563-150431585 CTTGTGATACATTAAAAACATGG + Intergenic
940435093 2:153642564-153642586 TTTTAAAAACATATAAAACAGGG + Intergenic
941725284 2:168853783-168853805 CCTGTGACACAGATAAAAGAAGG - Intronic
943445586 2:187983090-187983112 ACAGAAACACATATAAAACAAGG + Intergenic
943830671 2:192457437-192457459 CTTGAGATACATACAAATGATGG + Intergenic
944876710 2:203969561-203969583 CTAGAGACACAAAGAAAACATGG - Intergenic
946977269 2:225167018-225167040 CTTGGGACACATAAAAGATAGGG + Intergenic
947410031 2:229827868-229827890 CTTGGGCCACACATAAAATACGG - Intronic
947479362 2:230483906-230483928 ACAGAAACACATATAAAACAAGG - Intronic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
1170061198 20:12261083-12261105 CTTGAGACATATCTCAAGCAAGG + Intergenic
1170446331 20:16431722-16431744 CCCTAGACACATATATAACATGG + Intronic
1170510801 20:17074855-17074877 CATGTGGCACATATATAACATGG + Intergenic
1170621966 20:18003981-18004003 CTCGAGACACATATAGGACATGG + Intronic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1171224873 20:23434104-23434126 CTAGAGACACACATAAAATAAGG + Intergenic
1171513110 20:25703851-25703873 CCTGGGACACATTTAAAGCAGGG - Intergenic
1172648802 20:36488552-36488574 ACAGAGACACACATAAAACAAGG - Intronic
1176652105 21:9558856-9558878 CATTAGACACATATTACACATGG + Intergenic
1177238937 21:18430730-18430752 CATGAGACACAGGGAAAACAAGG + Intronic
1178206793 21:30477274-30477296 CTTTATAAACATATAAAAAATGG - Intergenic
1178389075 21:32183996-32184018 CCTGAGACTCATATATAACTTGG - Intergenic
1179126206 21:38592950-38592972 CCTGACACACACATAAAAAATGG - Intronic
1180541754 22:16455657-16455679 CATGTGACACATATACACCATGG + Intergenic
1181662076 22:24358888-24358910 CTTCAGACAGATACATAACATGG - Intronic
1182081658 22:27533556-27533578 CTTTAGACAGAAAGAAAACATGG + Intergenic
1183748865 22:39707803-39707825 CTTGAAACACCTAATAAACAAGG + Intergenic
1203239873 22_KI270733v1_random:6042-6064 ATTGTGACACATATACACCATGG + Intergenic
949615204 3:5746046-5746068 CTTGAAACACTTATAAACCAGGG + Intergenic
951064132 3:18244244-18244266 CTTGGGACACATATCACAGAGGG - Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951142475 3:19180955-19180977 CTAGAGACAGAAATATAACATGG + Intronic
951424539 3:22528424-22528446 AATGTGACACATATATAACATGG - Intergenic
955552701 3:60101165-60101187 CTTGACACAAATGTAAAGCAGGG + Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
956130498 3:66048855-66048877 ATGGAGACACATTTACAACATGG + Intergenic
956177373 3:66485492-66485514 ACTGAGACACATCTAAAAGATGG - Intronic
956995141 3:74818509-74818531 CTCAAGACAGACATAAAACAAGG + Intergenic
957221406 3:77387579-77387601 TTTGAGACAGAAATAATACAGGG - Intronic
957656724 3:83088225-83088247 ACAGAAACACATATAAAACAAGG - Intergenic
957879470 3:86192229-86192251 TTTGAGATACATTTAAAACTTGG + Intergenic
957898353 3:86452682-86452704 ATTGTGACACATATACACCATGG - Intergenic
958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG + Intergenic
959387108 3:105723770-105723792 CTTGAAAAACATTTAAAAGAAGG - Intronic
960077504 3:113504367-113504389 CTTGAGCCAAATATAAATCATGG - Intronic
960461876 3:117945784-117945806 CTTCAGACATTTATAGAACAAGG - Intergenic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
961350382 3:126297177-126297199 CTTTAAGCAAATATAAAACAGGG - Intergenic
962237487 3:133718842-133718864 ATAGAGACACATGTAAGACAAGG + Intergenic
962268633 3:133961846-133961868 GTTCTGACACATATAAAAAAGGG + Intronic
962272246 3:133986441-133986463 CTTGAGACACATCTTATAGAAGG + Intronic
962735873 3:138324744-138324766 CTTGAGCCTCATAAAAAACCAGG - Intronic
963231600 3:142914010-142914032 CTTGCCACACACATAAAATATGG - Intergenic
963499820 3:146112281-146112303 AATGTGACACATATACAACATGG + Intronic
964521540 3:157574542-157574564 CTTAAGACAGATAAAAAGCAAGG - Intronic
965169279 3:165240410-165240432 CATTAGGCACTTATAAAACAAGG + Intergenic
965503534 3:169484340-169484362 ATTGAGAGACATAAAAAATATGG + Intronic
966326098 3:178756432-178756454 CATAAAACACACATAAAACAAGG - Intronic
968339028 3:197939288-197939310 CTTGAAATACAAATAAAAAAAGG + Intronic
970309708 4:14769364-14769386 CCCGAGACACAAACAAAACAGGG - Intergenic
971235766 4:24840844-24840866 ACAGAGACACACATAAAACAAGG + Intronic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
972107613 4:35509914-35509936 CTCAAAACACGTATAAAACATGG - Intergenic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
974847546 4:67368829-67368851 CTTCAGACACAGCTAAATCAAGG + Intergenic
974866324 4:67585361-67585383 CCAGAGACAAATTTAAAACATGG + Intronic
975321779 4:73016704-73016726 CTTGGCACACATATAACAAAAGG + Intergenic
975324070 4:73040366-73040388 CTTAAGATACATATGAAATATGG - Intergenic
975814562 4:78204137-78204159 GTAGAAACACACATAAAACAAGG + Intronic
976348048 4:84027904-84027926 GTTTATACACCTATAAAACATGG - Intergenic
976514165 4:85945367-85945389 CTTGAGACATATAGAAACCTAGG - Intronic
976868510 4:89761555-89761577 CTTGAGGCACATAAAAATTAAGG + Intronic
977109011 4:92926969-92926991 TAGGAGACACATTTAAAACATGG + Intronic
977146976 4:93455381-93455403 TTTCAGACACAGATAACACAGGG - Intronic
977863474 4:101995303-101995325 AATGTGACACATATACAACATGG - Intronic
980161058 4:129163392-129163414 CTTGTGACCCATATTAAGCATGG - Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
981598510 4:146456263-146456285 ATTGATACACCTCTAAAACAGGG + Intronic
982031521 4:151306529-151306551 CTGGAGACTCAACTAAAACAGGG + Intronic
983322956 4:166217155-166217177 ATTGAAACACAAAGAAAACAAGG - Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984135069 4:175926172-175926194 ATTCAAACACATTTAAAACATGG + Intronic
984831412 4:183978366-183978388 GTTGACAAAAATATAAAACACGG - Intronic
985302200 4:188502731-188502753 CTTGGTATACATATCAAACAAGG + Intergenic
1202753322 4_GL000008v2_random:30102-30124 AATGTGGCACATATAAAACATGG + Intergenic
986473747 5:8102695-8102717 TATAAGACACATATAAGACATGG - Intergenic
988377493 5:30455988-30456010 ATTGTGACACATATACACCATGG - Intergenic
990397356 5:55395823-55395845 CTTGAGAGACACAGAAAACTGGG + Intronic
990488563 5:56282347-56282369 AAAGACACACATATAAAACAAGG + Intergenic
993340013 5:86713360-86713382 CTTGACATTCATTTAAAACATGG - Intergenic
993890394 5:93465707-93465729 AATGTGACACATATACAACATGG + Intergenic
998785310 5:145702312-145702334 CTTCAGACACAGATGAGACAAGG - Intronic
998843801 5:146284399-146284421 CCTGACACAGATATAAACCATGG + Intronic
999254801 5:150204360-150204382 CTTGGGACTCAGATAAGACAAGG + Intronic
1000387322 5:160687282-160687304 CTAGAGATACATAAAAAAAATGG - Intronic
1000499045 5:162024790-162024812 CTTGAGGTAAATATAAATCAAGG - Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004078568 6:12368457-12368479 CTTGATACACATAGTTAACATGG + Intergenic
1004156839 6:13176851-13176873 CTAGAGATACATTTTAAACATGG + Intronic
1004907423 6:20249294-20249316 TTTGAGGCATATAAAAAACATGG - Intergenic
1005216576 6:23535143-23535165 TTTGAGACACATATAGCACTTGG + Intergenic
1006767267 6:36518727-36518749 CTTGTGACACTTAAAAAAGAGGG - Intronic
1007499240 6:42282897-42282919 AAGCAGACACATATAAAACAAGG - Intronic
1008925738 6:56890547-56890569 TTTTAGAAACATCTAAAACAAGG + Intronic
1009605974 6:65867632-65867654 CGTGTGACACATACACAACATGG + Intergenic
1010946327 6:81977253-81977275 CTTCAGACAAATATAAAATTAGG - Intergenic
1011334281 6:86242777-86242799 AATGTGACACATATAAACCATGG + Intergenic
1012130567 6:95486608-95486630 TTTGAGAAACATGTCAAACAGGG - Intergenic
1012680069 6:102169095-102169117 AATGTGACACATATAAACCATGG + Intergenic
1012895112 6:104938833-104938855 CCTGTGACACAAATAAAAAATGG - Intergenic
1013579748 6:111521918-111521940 CTTGTGACCCATACAAAACCAGG + Intergenic
1013839929 6:114379277-114379299 GTTGAGACCCATAGAGAACATGG - Intergenic
1013922965 6:115432070-115432092 CTGGAGAAATATATAAAATATGG + Intergenic
1015294640 6:131576714-131576736 CTTGAGAAACTTAAAGAACAAGG + Exonic
1016103819 6:140137196-140137218 CTTGCTACAAATATAAAACTGGG - Intergenic
1016725022 6:147353997-147354019 CATGTAATACATATAAAACATGG + Intronic
1017142689 6:151206068-151206090 CCTTGCACACATATAAAACACGG + Intergenic
1017347422 6:153400461-153400483 CCAGAAACACATACAAAACAAGG + Intergenic
1021018126 7:15561492-15561514 CTGGAGTGACATATAAAAGAGGG + Intronic
1022270346 7:28801010-28801032 CTTGTAAAACATATAGAACAAGG + Intronic
1022946015 7:35284289-35284311 CTTGAGACACTTCTCAAAAAAGG + Intergenic
1024432967 7:49311835-49311857 TTTAATACACATTTAAAACATGG - Intergenic
1024702962 7:51924586-51924608 AATGTGACACATATACAACATGG - Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1024960189 7:54966349-54966371 ATTGAGATAGATACAAAACAGGG + Intergenic
1026579987 7:71607432-71607454 CTTGAAACACATAGAAAAGTTGG + Intronic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1028724556 7:94072547-94072569 CTTGAAACACACAGAAAACTGGG - Intergenic
1030333333 7:108296469-108296491 CTTCAGTCACATATCAGACATGG - Intronic
1030360345 7:108588946-108588968 CTTGAGATACTTAGAAAACTAGG + Intergenic
1030763506 7:113380180-113380202 CTTGAGATACAAATGATACATGG - Intergenic
1030983877 7:116217730-116217752 CTTGAGGCAAATTTTAAACATGG - Intronic
1031603237 7:123738830-123738852 CTTGAGTCACACACAAAATACGG + Intronic
1032460967 7:132110989-132111011 CTTGAGGCAAATATCCAACAGGG - Intergenic
1037278373 8:17206350-17206372 GTAGAAACACACATAAAACAAGG + Intronic
1037554880 8:20012661-20012683 ACTGAGACACAAATAATACAGGG + Intergenic
1037613455 8:20495808-20495830 CTTAAGAAACTTATAACACATGG + Intergenic
1038160535 8:25032984-25033006 CTTGAGACACAAATGACATATGG + Intergenic
1040853583 8:51926372-51926394 GTTGAGACAGAAATAATACAGGG + Intergenic
1043209446 8:77492463-77492485 CTTGTAACACATGTTAAACATGG + Intergenic
1043251563 8:78080241-78080263 CTTGAGACACAATTGAAATAAGG - Intergenic
1044665786 8:94633242-94633264 CTTCAAACAGACATAAAACAGGG + Intergenic
1044850375 8:96421472-96421494 CTTGTGGCACATATACACCATGG - Intergenic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1045275517 8:100701034-100701056 CTTAACAAACACATAAAACAAGG - Intronic
1045495948 8:102708718-102708740 CTTTAGGCACATATACACCATGG - Intergenic
1045729913 8:105225788-105225810 CTAGAGATAAAAATAAAACAAGG + Intronic
1046456019 8:114462333-114462355 TTTAAGACACATATAATACTTGG - Intergenic
1047711321 8:127555434-127555456 CCTAAGTCACATATAAACCATGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048711064 8:137211198-137211220 CATGATACAAATAGAAAACAAGG + Intergenic
1048765043 8:137834540-137834562 CATGAGACAGATAAGAAACAAGG + Intergenic
1049117395 8:140701081-140701103 CTTGAAAGACACATAAAACAAGG - Intronic
1050192790 9:3045872-3045894 CTTGAGACAGAAATACAACCAGG - Intergenic
1050751072 9:8938008-8938030 GTTGAGAACCATATAAAACTAGG - Intronic
1051820314 9:21158289-21158311 TGTGAGACACAGCTAAAACACGG + Intergenic
1051900942 9:22039428-22039450 ATTAAGACACAGCTAAAACAGGG - Intergenic
1052335518 9:27315594-27315616 TTTGAGAAATATATAGAACATGG - Intergenic
1055346088 9:75340919-75340941 AATGAGACACATATACACCATGG - Intergenic
1055687929 9:78797864-78797886 TTTGAGACAAATGGAAAACATGG - Intergenic
1055819442 9:80244215-80244237 CTTGAGAAAGATCTTAAACAAGG + Intergenic
1057074310 9:92128059-92128081 ATTGAGAAGCATATAAAAAATGG - Intergenic
1057084979 9:92201591-92201613 ATTGAGAAGCATATAAAAAATGG + Intergenic
1057776338 9:98013333-98013355 CTAAAAACACATTTAAAACATGG - Intronic
1060928495 9:127472718-127472740 CTTGAGAGACAAAAAAAGCAAGG - Intronic
1203629833 Un_KI270750v1:62401-62423 CATTAGACACATATTACACATGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186589244 X:10912129-10912151 CAAGAGAAACACATAAAACAAGG - Intergenic
1186790119 X:12989046-12989068 CTCGAGACTCAGATAATACAGGG - Intergenic
1187025201 X:15428223-15428245 CTTGAAACACACATAAAAGAAGG + Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1192123612 X:68479736-68479758 TTAGAGACACATATAAAACATGG - Intergenic
1193329930 X:80224265-80224287 CTTGAGACACAAATAAATTTGGG - Intergenic
1194095530 X:89634240-89634262 CCTGAGATACATTTAAAATATGG - Intergenic
1194465034 X:94223287-94223309 CATAAAAGACATATAAAACAAGG - Intergenic
1194504683 X:94718669-94718691 CTTAAAAGACAAATAAAACATGG - Intergenic
1196019612 X:110976742-110976764 AATGTGACACATATACAACATGG + Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196885684 X:120243336-120243358 CTTAAGGCACAGATAAAACCAGG - Intergenic
1197189138 X:123625481-123625503 CTTCACACACATATAAAAGCAGG - Intronic
1197517132 X:127446957-127446979 CTTGGGCCACACATAAAATATGG - Intergenic
1198379231 X:136068607-136068629 CCTGGGACACAGATAACACATGG - Intergenic
1198703144 X:139418448-139418470 CTTCAGACAAATACAAGACACGG - Intergenic
1199665434 X:150092995-150093017 CTTGAGACATATTTAGAACAAGG + Intergenic
1199751361 X:150822711-150822733 TATGAGACACATATACAACTTGG - Intronic
1200448165 Y:3290422-3290444 CCTGAGATACATTTAAAATATGG - Intergenic