ID: 971766523

View in Genome Browser
Species Human (GRCh38)
Location 4:30839264-30839286
Sequence ATAGCCAAAAGGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971766520_971766523 10 Left 971766520 4:30839231-30839253 CCTGAATTATCATTATTCATTAG 0: 1
1: 0
2: 0
3: 23
4: 272
Right 971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG 0: 1
1: 0
2: 3
3: 44
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971766523 Original CRISPR ATAGCCAAAAGGAATGAGAA GGG Intronic
901610729 1:10495886-10495908 AAAGCAAAAAAGAATGAAAATGG - Intronic
904519049 1:31079983-31080005 AAAGCCTAAAGGAAAAAGAAAGG + Intergenic
908147108 1:61258167-61258189 TTAGCCAAAAGTTATGAAAATGG - Intronic
908877844 1:68698154-68698176 ATAACACAAAGGAATGATAAAGG + Intergenic
909641808 1:77876596-77876618 ATAACTAAAAGGAAGGAGAAAGG - Exonic
909983023 1:82127145-82127167 AAAACCAAAATGAAAGAGAAAGG + Intergenic
910030352 1:82713682-82713704 ATAGCAGAAAGGAAGGAGATGGG - Intergenic
911476750 1:98382562-98382584 ATAACCAAATGGCATGAGAAGGG + Intergenic
911543864 1:99191792-99191814 AAGGCCAAAAGGAATCAAAATGG + Intergenic
913183933 1:116349623-116349645 AGAGCAAAAGGGTATGAGAATGG + Intergenic
914018235 1:143841146-143841168 ATACACGAAAGGAATGAAAATGG + Intergenic
914390027 1:147212672-147212694 ATAGGCAAAAATACTGAGAAAGG - Intronic
916146794 1:161747022-161747044 ATAGCCAAAAGAATTGAAAGTGG - Intergenic
917493681 1:175520703-175520725 ATAGCCAGAAGGGAGGAGAGAGG - Intronic
917956383 1:180102969-180102991 ATAGGCAGAAGAAATGAGAGAGG + Intronic
919156001 1:193766512-193766534 ATAGCCGGAAGGTAGGAGAAAGG - Intergenic
919567590 1:199207996-199208018 ATACCAAAAAGGAATGTAAAGGG + Intergenic
920281693 1:204848214-204848236 ATTGCCAAAAGTGATGAAAAAGG - Intronic
922930357 1:229384190-229384212 CTAGCCAGAAGGAAGGAGGAAGG - Intergenic
923345215 1:233045046-233045068 ATAGCCCAAAAGAATGATCAAGG - Intronic
924480372 1:244426211-244426233 TTATTCAAAAGAAATGAGAATGG - Intronic
1063215182 10:3918453-3918475 ATGGCCAACAGGTATGTGAAAGG - Intergenic
1064169408 10:13017008-13017030 ATTTCCAAAAGGAATGAGCTAGG + Intronic
1064690857 10:17917191-17917213 ACAAACAAAAGGAAAGAGAAAGG - Intergenic
1064777685 10:18797173-18797195 ATATCAAAAAGGAAAAAGAAGGG + Intergenic
1065253774 10:23844042-23844064 ATAGCTACAAGGTATGAAAATGG + Intronic
1066023212 10:31322092-31322114 AGAGCCAAAAGTGATGAAAATGG - Intronic
1068170365 10:53385340-53385362 ATAGAAAAAATAAATGAGAAAGG - Intergenic
1068861409 10:61851583-61851605 ATAGCACAAAGGAAAGAAAAAGG - Intergenic
1068888721 10:62126105-62126127 ATATTCAAAAGGAAGTAGAATGG + Intergenic
1069925501 10:71847610-71847632 ATAGGCAGAAGAAAGGAGAAAGG - Intronic
1071320071 10:84446065-84446087 ATAATGAAAAGAAATGAGAAAGG - Intronic
1071888551 10:89977467-89977489 AAAGCCAAAACCAAGGAGAAAGG - Intergenic
1072002553 10:91211051-91211073 AAAGCAAAAAGGAATGGTAATGG + Intronic
1072256474 10:93626055-93626077 ATAGCACACAGGAAAGAGAAGGG + Intronic
1072582905 10:96755573-96755595 AAATCGAAAAGAAATGAGAATGG + Intergenic
1072770589 10:98134457-98134479 ATAGCCGAGAGGAATGAGGAAGG + Intergenic
1073085101 10:100883278-100883300 ATGGCCAGAAGGGGTGAGAAGGG + Intergenic
1073653349 10:105384992-105385014 AGAGCCAAGATTAATGAGAAGGG + Intergenic
1073728338 10:106260743-106260765 ATAGCAAAAATGAATGAGAGTGG + Intergenic
1074840832 10:117349271-117349293 AGAGGCAGAAGGAATGAGAAGGG + Intronic
1075267944 10:121021219-121021241 AGAGACAGAAGGCATGAGAAAGG - Intergenic
1076009489 10:126976112-126976134 ATATCAAAAAGGAAAAAGAAAGG - Intronic
1076173567 10:128344938-128344960 CTAGCACAAAGGAAGGAGAAGGG - Intergenic
1076537019 10:131185860-131185882 ATACCCAAAAGAATTGAAAACGG + Intronic
1077447982 11:2610528-2610550 ATATCCAAAAGCAAAGAGCAAGG - Intronic
1077868532 11:6242298-6242320 ACAGCCAAGTGGAAAGAGAAAGG + Intronic
1078507490 11:11963657-11963679 CTCCCCAAAAGGAAGGAGAATGG - Exonic
1078662729 11:13300015-13300037 ACAGCCATGAGGAATGGGAAGGG - Intronic
1078949011 11:16107242-16107264 ATATCCAAAAGGATTGAAAGTGG + Intronic
1078977368 11:16494398-16494420 ATAAATAAAATGAATGAGAAAGG + Intronic
1079576480 11:22009672-22009694 AAAGACAACAGGAATCAGAAAGG + Intergenic
1079857142 11:25619776-25619798 AAAGACAAAAGGCATGAGAAAGG - Intergenic
1081451994 11:43179944-43179966 ATATCCAAGATGGATGAGAAAGG + Intergenic
1082131325 11:48493042-48493064 ATATCCAAAAGAAATGAAATCGG - Intergenic
1082211208 11:49504304-49504326 ATAGCCAAAAGAAATGAAATTGG + Intergenic
1082728769 11:56769610-56769632 TTAAAGAAAAGGAATGAGAAGGG - Intergenic
1084023164 11:66430388-66430410 GGAGCAAAAAGGTATGAGAAAGG + Intergenic
1085228202 11:74941828-74941850 ACAGAAAAAAGGAATGAGAAAGG + Intronic
1086199699 11:84186714-84186736 ATAATCAGAATGAATGAGAATGG + Intronic
1086638435 11:89120750-89120772 ATAGCCAAAAGAAATGAAATTGG - Intergenic
1086685140 11:89725006-89725028 ATAGGCAAACAGAATGACAAAGG - Intergenic
1087318085 11:96628081-96628103 AAAGCCAAAAGGAAAAGGAAAGG + Intergenic
1087468097 11:98535754-98535776 ATTACCAAAAGTAAAGAGAAAGG + Intergenic
1088365483 11:109036080-109036102 ATAGTCAAAAAGTCTGAGAAGGG - Intergenic
1089947805 11:122495652-122495674 ATTGCAGAAAGAAATGAGAAAGG + Intergenic
1090679407 11:129037666-129037688 AAAGCCATAAGGAATTACAAGGG + Intronic
1091036935 11:132243128-132243150 AGAGCCAAAAACATTGAGAAGGG - Intronic
1091345927 11:134853949-134853971 ATAGCCCACAGAAATGACAAAGG + Intergenic
1092737138 12:11593231-11593253 TTAGCCAATTGGAATGAAAATGG + Intergenic
1092804740 12:12210259-12210281 ATATGAAAGAGGAATGAGAAAGG + Intronic
1093421636 12:18980826-18980848 ATAGGCAGAAGAAAAGAGAAAGG + Intergenic
1093683739 12:22032402-22032424 AAATCCAAAAGTAATGAGGAAGG + Intergenic
1094031595 12:26017961-26017983 ATAGCCAATGGGAAAGGGAAAGG - Intronic
1095118029 12:38379757-38379779 ATAGACATAAGAAATGAGATAGG - Intergenic
1095307572 12:40656154-40656176 GTAGCCAAAAGTATTGAGGAAGG + Intergenic
1095674897 12:44904839-44904861 ATAGCTTAAGGGAATGAGATAGG + Intronic
1096179263 12:49541659-49541681 ATACCCATAAAGAATGAGAAAGG + Exonic
1097213274 12:57389111-57389133 ATAACCAAAAGGATAGAGATGGG + Intronic
1097740673 12:63238606-63238628 ATAGCACAAAGGAGGGAGAAAGG - Intergenic
1098072465 12:66690510-66690532 ATATCCAAAAGAAATGAAATCGG - Intronic
1098660252 12:73084390-73084412 ATAGTTGAAAGGAATGAGAAAGG + Intergenic
1099388318 12:82046833-82046855 AGGACCAAAAGGCATGAGAATGG + Intergenic
1099812888 12:87607349-87607371 ATAGCAAAATGAAATGAGAGTGG + Intergenic
1100384455 12:94092606-94092628 ATAGCCAAAAGTAACTAAAATGG - Intergenic
1101064242 12:101002801-101002823 GCAGCCAAAAGTAATTAGAAGGG + Intronic
1101157038 12:101937559-101937581 TTAGGCAAAAGGAGTGGGAAGGG - Intronic
1101533584 12:105596751-105596773 ATAGACAATAAGAATCAGAAAGG + Intergenic
1101603356 12:106229594-106229616 AAAGCCAAATGGACTGAGAGTGG + Intergenic
1102087574 12:110155815-110155837 ATACACAAAGGAAATGAGAAAGG - Intronic
1103136132 12:118509448-118509470 GGAGCCAAAAAGAAAGAGAAAGG - Intergenic
1104620390 12:130307627-130307649 AGAGCCAAAAGGGATGAGCAAGG - Intergenic
1105592093 13:21801810-21801832 ATTCCAAAAAGGAAAGAGAAAGG + Intergenic
1107215737 13:37916520-37916542 AAAGACAAAAGGAAGGAGATTGG - Intergenic
1107340586 13:39400892-39400914 GTAGTGAAAAGGAATGATAAAGG - Intronic
1107521359 13:41185386-41185408 ATTACTAAAAGGAAGGAGAATGG - Intergenic
1107915617 13:45146678-45146700 AAAGGCAACAGGAATGAGACCGG + Intronic
1108305265 13:49125244-49125266 ACAGCCAAAAGGGATGGGCAGGG + Intronic
1109045757 13:57409027-57409049 ATTAACAAAAGGAATGTGAAAGG + Intergenic
1110365249 13:74676306-74676328 ATAACCAAAAACAATGTGAAAGG - Intergenic
1110457159 13:75702245-75702267 AGAGCCAGAAGGAAGGAGCAGGG - Intronic
1110457668 13:75708554-75708576 ATAGCCAAAAAGCATGAAATAGG - Intronic
1110557776 13:76879605-76879627 ACAGGCAAAAGGAAAGAGGAAGG + Intergenic
1111397269 13:87678795-87678817 ACAAAGAAAAGGAATGAGAAGGG - Exonic
1111811401 13:93096888-93096910 ATAGCCAGGGGGAAAGAGAAGGG - Intergenic
1112915368 13:104542830-104542852 ATAGCCAATAGATATGTGAAGGG + Intergenic
1112993522 13:105543719-105543741 ATAGATAAAACCAATGAGAATGG - Intergenic
1114336389 14:21695158-21695180 ATAAGGAAAATGAATGAGAAAGG + Intergenic
1114601653 14:23960182-23960204 GTAGCAGAAACGAATGAGAAGGG - Intronic
1115519354 14:34217656-34217678 ATATCTAGAAGGTATGAGAAGGG - Intronic
1115727679 14:36234946-36234968 ATAGCCCCAAGCAATGAGGAAGG + Intergenic
1115925658 14:38430638-38430660 ATCACCAAAAAGAATGAGAGTGG + Intergenic
1116466569 14:45240260-45240282 ATAGCAAAGAGGACTGAGAAGGG + Intronic
1117195655 14:53337539-53337561 ATAGTAAAAAGCAATGAGAGAGG + Intergenic
1117354587 14:54911691-54911713 AAAGCCAAAAGGAATGAAACTGG - Intergenic
1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG + Intronic
1119218271 14:72885745-72885767 AAACCCAAAAGAAATGAAAATGG + Intronic
1120173550 14:81270587-81270609 ATGGCTAAAAGGAATAAGAGGGG + Intronic
1120544701 14:85796521-85796543 ATAGCCAAATGGAAACAGAAGGG + Intergenic
1120907038 14:89629810-89629832 ATTGTCAAAAGGCATGAAAATGG - Intronic
1121860203 14:97310145-97310167 AGAGGCAAAATGCATGAGAACGG + Intergenic
1121962724 14:98276040-98276062 ATATCCAGAAGGAATGAAAAGGG - Intergenic
1121974570 14:98391030-98391052 AAAGACAAAAGGCATGAGCAAGG + Intergenic
1122730636 14:103794696-103794718 CTAGGTAAAAGGACTGAGAAAGG + Intronic
1123953461 15:25308750-25308772 ATATAAAAAAGAAATGAGAAGGG - Intergenic
1123981218 15:25606276-25606298 ATCTCCAAAAGAAAAGAGAAAGG - Intergenic
1125152089 15:36544552-36544574 AAATCCAAAAGGAATGAAACTGG + Intergenic
1125878400 15:43169633-43169655 ATATCTAAAAATAATGAGAATGG - Exonic
1125990577 15:44102909-44102931 AGACCTAAAAGGAATGAAAAGGG + Intronic
1126037587 15:44561024-44561046 AAAGCCAAAAAGAAGAAGAAAGG + Exonic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1127428228 15:58876695-58876717 TAAGTCAAAAGGAAAGAGAAAGG + Intronic
1127564707 15:60175795-60175817 ACAGCAAAAAGGGAAGAGAAAGG + Intergenic
1128171002 15:65513019-65513041 ATAACCACAACAAATGAGAACGG + Intronic
1129202992 15:74016648-74016670 ATAGCAAAAAGGAAAGGAAAAGG - Intronic
1129914616 15:79257855-79257877 ATAGGCAAAAGAAAAGAGAGAGG - Intergenic
1129956869 15:79646289-79646311 ATAGACAGAGGGAAAGAGAAAGG + Intergenic
1130154209 15:81335698-81335720 ACAGCCTACATGAATGAGAATGG - Intronic
1130561955 15:84965784-84965806 CTAGCCAGAAGGAAAGAGGAAGG - Intergenic
1130768753 15:86902771-86902793 ATAGGGAAAAGCAATTAGAATGG - Intronic
1131246436 15:90797737-90797759 ATAGCTGAAGGAAATGAGAAAGG + Intronic
1131497573 15:92926450-92926472 ATAAGCAAAAGGAATTTGAATGG - Intronic
1132868046 16:2103543-2103565 ATAGCCAAAGGGAAAGGGATTGG + Exonic
1134376421 16:13679235-13679257 GTAGCCAAAAAGCAGGAGAATGG - Intergenic
1134413210 16:14020719-14020741 ATTGGCAACAGGAAGGAGAATGG - Intergenic
1134523727 16:14929581-14929603 ATAGCCAAAGGGAAAGGGATTGG - Intronic
1134549174 16:15131355-15131377 ATAGCCAAAGGGAAAGGGATTGG + Intronic
1134711318 16:16328066-16328088 ATAGCCAAAGGGAAAGGGATTGG - Intergenic
1134955511 16:18380627-18380649 ATAGCCAAAGGGAAAGGGATTGG + Intergenic
1135852085 16:25972986-25973008 ATCCCCAACAGCAATGAGAAGGG - Intronic
1135996810 16:27256127-27256149 CAAGCCAAGAGGTATGAGAAAGG - Intronic
1136374100 16:29854900-29854922 AGAGCCAACAGGAAGGAGAAAGG + Intergenic
1137028715 16:35502579-35502601 ACAGCCAAGATTAATGAGAAAGG - Intergenic
1137030157 16:35516350-35516372 ATGGCCAAGAGGAATTTGAAAGG + Intergenic
1137328503 16:47466027-47466049 ATATCCAGAAGGAATATGAAGGG - Intronic
1139403618 16:66701247-66701269 ATACCCAAAAGAACTGATAATGG + Intergenic
1140387907 16:74558756-74558778 ATAGTCAGAAGAAAAGAGAAGGG + Intronic
1140589171 16:76331156-76331178 ACAACAAAAAAGAATGAGAATGG - Intronic
1140701154 16:77582676-77582698 AAGCCCAAAAGGAAGGAGAATGG - Intergenic
1140817733 16:78636550-78636572 GTAAGCAAAAGGACTGAGAATGG - Intronic
1140916910 16:79502149-79502171 ACAGCCAGAAGGACTCAGAAAGG + Intergenic
1141138847 16:81484213-81484235 TTTGCCAGAAGGAATGGGAACGG - Intronic
1141181284 16:81754503-81754525 ATAGGCAAAAGGAAATGGAAAGG - Intronic
1141291900 16:82725738-82725760 AGAGCCAAAAGGAATGAGGATGG - Intronic
1141305041 16:82854901-82854923 ATTGTCCAAAGCAATGAGAAAGG - Intronic
1144171308 17:12662410-12662432 AAAGCCAAAATGAAGGGGAAAGG + Intergenic
1145020202 17:19424282-19424304 ATTGACAAATGGAATAAGAAAGG - Intergenic
1145120296 17:20253307-20253329 ATCCCCAAAAGCAATGAAAAGGG - Intronic
1146413459 17:32610041-32610063 AAAGCCTAAAGAAATGAGAATGG + Intronic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1146875257 17:36404950-36404972 ATAGCCAAAAGTGATGAACAGGG - Intronic
1146978578 17:37138208-37138230 ATGGCCAATCTGAATGAGAAGGG + Intronic
1147064131 17:37907917-37907939 ATAGCCAAAAGTGATGAACAGGG + Intergenic
1147388967 17:40097861-40097883 GTAGCCAACAGTAAAGAGAATGG + Intronic
1148470204 17:47888540-47888562 GTAGACAAAAGGAACGAGAGAGG + Intergenic
1151212565 17:72555434-72555456 AGAGCCAAAAGAAATGACAAAGG + Intergenic
1152455186 17:80411322-80411344 TTAGCCAAAATGAAAGAAAAAGG + Intergenic
1153823152 18:8849663-8849685 ATAGGAAACATGAATGAGAAAGG - Intergenic
1155492751 18:26416285-26416307 ATATGCAAGAGGACTGAGAAAGG - Intergenic
1156343046 18:36229425-36229447 AAAGTCAAAAGGAAGGAAAAAGG - Intronic
1156660929 18:39345777-39345799 ATTGCCATCAGGATTGAGAAAGG + Intergenic
1157484749 18:48079039-48079061 ATACCCAAAATAAATGAAAATGG - Intronic
1157489883 18:48115698-48115720 ATACCCCAAAGGATTGAAAACGG - Intronic
1157977248 18:52340930-52340952 CTCGCCAAATGAAATGAGAAGGG - Intronic
1158525627 18:58210195-58210217 ATAGATAATAGGAATGAGAAAGG + Intronic
1158933118 18:62340209-62340231 AAACCCAAAACGAATGATAAAGG - Intronic
1159322847 18:66876060-66876082 TTATCCAAAAGGAATAAAAATGG - Intergenic
1159520244 18:69510878-69510900 TTAGCCAAAAAGAAAGAAAAAGG - Intronic
1159851321 18:73530075-73530097 ATGGACAAAAAGAATAAGAAAGG + Intergenic
1160607776 18:80065418-80065440 ACAGAAAAAAGGAATGAGGAAGG + Intronic
1163195075 19:15713041-15713063 CTATCCAAAAGATATGAGAAGGG - Intergenic
1164833230 19:31339243-31339265 AAAGAGAAAAGGAATGAGAAAGG + Intronic
1164903472 19:31947776-31947798 AGAGCCAAAAGGCAGAAGAAGGG - Intergenic
1165445081 19:35852263-35852285 AGAGACAAAAGGAGAGAGAACGG - Intronic
1165583885 19:36895381-36895403 ATACACAAATGGAAAGAGAAAGG + Intronic
1166574893 19:43828063-43828085 AAAACCAAACGGAATGAAAAGGG - Intronic
1166660911 19:44646986-44647008 ATAGCCAAAGTGAAGGAGCACGG + Intronic
1166981316 19:46633923-46633945 ACACTCAGAAGGAATGAGAACGG + Intergenic
1167001552 19:46748132-46748154 AAAGCCTTAAGGAATGAGGAAGG - Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929270301 2:39964480-39964502 GTAGGCAAAAGGAAAGAGAAAGG + Intergenic
929278809 2:40055397-40055419 ATTGCCAGAAGGTATAAGAAGGG - Intergenic
929714304 2:44294828-44294850 ATCTCAAGAAGGAATGAGAAAGG - Intronic
929843198 2:45493066-45493088 ATAGGCAGAAGGAAGGAAAAGGG - Intronic
929862972 2:45694968-45694990 ATAGCCAAACTGAAGGAGAAGGG - Intronic
929864508 2:45706854-45706876 ACAGGAATAAGGAATGAGAAAGG - Intronic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
930235011 2:48880425-48880447 ATGGACAAAGGGTATGAGAAAGG + Intergenic
930505527 2:52279025-52279047 ATGGCCAATAAGAATGTGAAGGG - Intergenic
931368468 2:61640080-61640102 ATAGGCAGAAGGGAAGAGAAAGG - Intergenic
931595323 2:63935990-63936012 GAAGCCAAGAGGAAAGAGAAAGG + Intronic
933560347 2:83878793-83878815 ACAGACAAAAGGAAAAAGAAGGG + Intergenic
933863663 2:86496408-86496430 ATATACAAAAGGAAAGAAAAGGG - Intergenic
933950399 2:87324197-87324219 AAAACCAAGAGTAATGAGAAGGG - Intergenic
934074250 2:88414187-88414209 ATACACAAAATGAATCAGAAAGG + Intergenic
934161962 2:89258166-89258188 GTAGCCAAAAGAGATTAGAATGG + Intergenic
934205320 2:89924196-89924218 GTAGCCAAAAGAGATTAGAATGG - Intergenic
934309291 2:91849173-91849195 ACCGCTAAAAGGAATGCGAAGGG + Intergenic
934959049 2:98651560-98651582 ATACACAAAAGGAAATAGAAAGG + Intronic
935104588 2:100028919-100028941 ATATCCAAAAGAACTGAGAGCGG + Intronic
936329379 2:111534375-111534397 AAAACCAAGAGTAATGAGAAGGG + Intergenic
936613012 2:114019968-114019990 TGTGACAAAAGGAATGAGAATGG + Intergenic
938168274 2:129051714-129051736 ATATCCAAAAGGATTGAAAATGG + Intergenic
938233075 2:129678579-129678601 CTAGCCAAAAGGGACCAGAAAGG - Intergenic
938525005 2:132120976-132120998 AAAACCAAGAGGAATGAGATAGG - Intergenic
938585307 2:132684876-132684898 TTAGCCCAAATGGATGAGAAGGG + Intronic
939100484 2:137889961-137889983 ATAATCAAAAGAAATCAGAAAGG - Intergenic
939383126 2:141461996-141462018 ACAGCCAAAAGGCAGGAAAATGG - Intronic
939831486 2:147077583-147077605 ATAATCAAAAAGAATGATAATGG + Intergenic
940339216 2:152561911-152561933 TTAGCCAGAAGAGATGAGAAAGG - Intronic
941422274 2:165297403-165297425 ATGGTCAAAATTAATGAGAAAGG - Intronic
941662735 2:168212035-168212057 ATACCCAAAAGGAACCTGAATGG + Intronic
943202860 2:184851674-184851696 ATATCCAAAAGAAATGAAATTGG - Intronic
943647478 2:190422574-190422596 ATAAGCATCAGGAATGAGAATGG - Intronic
943838357 2:192544481-192544503 GTATCCAAAAGCAATGAGAAAGG - Intergenic
944427783 2:199601497-199601519 CTAGCCAAAAGGGAGAAGAAGGG + Intergenic
945438113 2:209843133-209843155 ATAATAAAAAGGAATCAGAATGG - Intronic
945861448 2:215127422-215127444 ATAGACATAAGAAATGAGATAGG - Intronic
946299746 2:218815296-218815318 GTAGTCAAAAAGAATGACAAAGG - Intergenic
946597199 2:221319198-221319220 ATAAGGAAAAGGAATGAGACAGG + Intergenic
946667798 2:222068879-222068901 AAAGGCACAAGGAATGAGAAGGG - Intergenic
946970036 2:225081385-225081407 ATAAAAAAATGGAATGAGAATGG + Intergenic
947004920 2:225499847-225499869 ATAGCAGAAGGGAAGGAGAAAGG + Intronic
948378929 2:237540063-237540085 TTAAACAAAAGGGATGAGAAGGG + Intronic
948475842 2:238218586-238218608 ATACCCAAAAGAATTGAAAATGG - Intergenic
1169514851 20:6304488-6304510 GTATCCAAAAGGAATGATAAAGG - Intergenic
1170354435 20:15477071-15477093 ATAGAGAAAAGGAATGGAAAAGG - Intronic
1170913516 20:20599666-20599688 ATAGGCAAAGGGTAGGAGAAAGG - Intronic
1171246311 20:23612616-23612638 AAAGCCAAAAGGACTCTGAATGG - Intergenic
1173912279 20:46679250-46679272 CTGTCCAAAAGGAATAAGAAGGG + Intronic
1174348848 20:49952304-49952326 AGAGCCCAAAGGGAAGAGAAGGG - Exonic
1176951774 21:15056011-15056033 AAACCCAAAAGGAAAGAAAATGG + Intronic
1176965706 21:15209337-15209359 ACAGCCAAAAGGAAGAAGAAGGG + Intergenic
1177696709 21:24582167-24582189 ATAGCCAGAAGGAAGAAGTATGG - Intergenic
1177727392 21:24987327-24987349 ATGCCCAAAAGGCATGAGATTGG + Intergenic
1177919145 21:27128820-27128842 GTAGCCAAAAGGACTTAGAAGGG + Intergenic
1178168070 21:30005488-30005510 ATAATGGAAAGGAATGAGAATGG + Intergenic
1183332368 22:37228498-37228520 AGAACCAAGAGGAAGGAGAAGGG + Intronic
1184907095 22:47495673-47495695 ATTGGCAGAAGAAATGAGAAGGG - Intergenic
949430856 3:3974074-3974096 ATAGCACAAAGGAATGAGGGAGG - Intronic
950545793 3:13637234-13637256 AGAGGGAAAAGGAAGGAGAAAGG + Intronic
951001542 3:17566499-17566521 ATAGCAAAAAGTAAACAGAAGGG - Intronic
951063677 3:18239151-18239173 ATAGCCAAAGGTTATGAAAAGGG + Intronic
951100175 3:18678272-18678294 ATAGCAAAAAAGAAAAAGAAAGG - Intergenic
951395561 3:22162079-22162101 AAATGCAAAAGAAATGAGAAGGG - Intronic
951487100 3:23225493-23225515 CAAGCCAAAAGGAATGAAATTGG - Intronic
951852125 3:27153019-27153041 ATAGACCTAAGAAATGAGAATGG + Intronic
952449226 3:33415572-33415594 ATACCCAGAAGTAAAGAGAATGG - Intronic
952606341 3:35151328-35151350 ATAGCCAAAAGGCAAGAGATGGG - Intergenic
954196534 3:49000432-49000454 ATTGCCAAGAGGAAGGAAAATGG - Intronic
955475312 3:59330278-59330300 AGAGCCAGAAGAAATAAGAAGGG + Intergenic
955736412 3:62043107-62043129 ACAGACAGAAGGCATGAGAAAGG + Intronic
956257010 3:67293768-67293790 ATAGGCAGAAGCAAAGAGAAAGG + Intergenic
956604269 3:71056446-71056468 ATGTCCAAAAGGAAAAAGAAGGG - Intronic
957487629 3:80883051-80883073 ATGGCAAAAGGGAATAAGAAGGG - Intergenic
957661363 3:83158248-83158270 ATAGTCAAGTGGAATGATAAAGG - Intergenic
957937805 3:86966958-86966980 ATTTCCAAAAGGTGTGAGAATGG + Intronic
958194603 3:90227930-90227952 AAAGAAAAAAGAAATGAGAAGGG + Intergenic
958417963 3:93898947-93898969 AAAGAAAAAAGAAATGAGAAGGG + Intronic
958696550 3:97535347-97535369 ATAGGAAAACGGATTGAGAAAGG + Intronic
959130491 3:102349979-102350001 TTAGGCAAAATGAATGTGAAGGG + Intronic
959133415 3:102386888-102386910 ACAGCCAAAAGGATTAAAAATGG - Intronic
959318944 3:104847030-104847052 TTAGCCAAAAAAAATTAGAATGG - Intergenic
959991260 3:112634787-112634809 ATACCCAAAAGAATTCAGAAAGG + Intronic
960566917 3:119143474-119143496 ATACAGAAAAGGAATGAGAAAGG + Intronic
960795171 3:121478057-121478079 ATAGCCATTAGGAAGGAGCAAGG + Intronic
961764306 3:129196908-129196930 GTATCCAAAAGGAAAGAAAAGGG - Intergenic
962159361 3:132982533-132982555 ATAGCCAAAAGAATTGAAAGAGG + Intergenic
962724740 3:138212634-138212656 ATAGAAAAAGGGAATGAAAATGG + Intronic
963192280 3:142486068-142486090 ACAGCAAAAAGAAATGACAAAGG - Intronic
963290424 3:143481539-143481561 AAAGCCAAACAGAATGAGATGGG + Intronic
963745854 3:149124610-149124632 AGAGCCAAATGTAATGAAAAGGG - Intergenic
965057412 3:163739752-163739774 ATAGTTAACAGGAATGTGAATGG + Intergenic
965359077 3:167714971-167714993 ATAGCCAAAAAGAATGAAACTGG + Intronic
965394214 3:168142585-168142607 AGAGCCCACAGGAATGAGGATGG + Intergenic
965723790 3:171691446-171691468 TTAACAAAAAGAAATGAGAAAGG - Intronic
966173137 3:177105603-177105625 ATTTCCAATAGAAATGAGAATGG + Intronic
967902159 3:194465539-194465561 TTAGCCACAAGGAATCAGGAAGG + Intronic
968259576 3:197309390-197309412 GTTCCCAAAAGGAATAAGAATGG - Intergenic
969142549 4:5091776-5091798 ATAGCCAACAAGAAGGAGTAGGG + Intronic
969456558 4:7303401-7303423 ACAGCAAAAAGGGATGAGACGGG - Intronic
970077045 4:12234409-12234431 ATAGACAAAAGAAATGAAATCGG - Intergenic
970086530 4:12353709-12353731 ATAGTCTACAGAAATGAGAAGGG + Intergenic
970825153 4:20263110-20263132 GTATCCAAAAGAAATGAGAGAGG - Intronic
971181329 4:24330912-24330934 ATGGGCAGAAGGAAAGAGAAGGG - Intergenic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
971865757 4:32169655-32169677 ATAACCTCCAGGAATGAGAAGGG - Intergenic
971954114 4:33393881-33393903 ATAGCCAACAGGTATATGAAAGG + Intergenic
972204879 4:36759733-36759755 ATAGGCAAAAGAAAGGAGAGAGG + Intergenic
972597637 4:40544185-40544207 ACAGCCAAAAAGAATGACAGAGG - Intronic
973133259 4:46674666-46674688 AAAGCCACAAGGCCTGAGAAAGG - Intergenic
976073695 4:81272652-81272674 ATAAATAAAAGAAATGAGAAAGG - Intergenic
976105545 4:81613312-81613334 AGAGCCAAGACCAATGAGAAGGG - Intronic
976397002 4:84566759-84566781 AGAGAGAAAAGAAATGAGAAAGG + Intergenic
976536915 4:86228046-86228068 TTATTGAAAAGGAATGAGAAAGG + Intronic
976851283 4:89548928-89548950 ATATCCAAAAGAAATGAAATTGG + Intergenic
976966958 4:91055118-91055140 AAACACAAAAGGGATGAGAAAGG - Intronic
977136895 4:93316076-93316098 ACATCCAAAAGGAAGGAGAGAGG + Intronic
977434535 4:96976428-96976450 ATAGCTAAAAGGGAGGAGGAAGG - Intergenic
978600636 4:110423901-110423923 GTAGCCAAAAGGGATGAGAAGGG + Intronic
979137814 4:117130835-117130857 TTACCCAAAAGCAATGGGAAAGG - Intergenic
979521101 4:121667662-121667684 ATAGGAAAGAGGAAAGAGAAAGG + Intergenic
980062900 4:128151490-128151512 ATAGCCAAAAAGAAAAAAAAAGG - Intronic
980759116 4:137204990-137205012 ATAGCCAAAAGAATTGAAATCGG - Intergenic
980903050 4:138923318-138923340 ACAGCCAAAAGGAAAAAAAAAGG + Intergenic
981285321 4:143010792-143010814 TTAGCAAGAGGGAATGAGAAAGG - Intergenic
982543819 4:156708879-156708901 CTAGGGAAAAGGCATGAGAATGG - Intergenic
982750667 4:159157549-159157571 TTAGCCAAAATGGATAAGAATGG + Intronic
982762189 4:159298580-159298602 ATAGCAGAAAGGAAAGAAAAAGG + Intronic
982796509 4:159652450-159652472 ATTGCCAAAAGAAATGTTAAAGG - Intergenic
982874658 4:160631013-160631035 ATAGTCAAAAGAAAAGACAATGG - Intergenic
983172627 4:164552915-164552937 AAAGCCCAGATGAATGAGAATGG - Intergenic
983486175 4:168333199-168333221 ACAGCAAAAAGAAATGAGTAAGG + Intergenic
983726250 4:170930449-170930471 ATTTATAAAAGGAATGAGAAAGG + Intergenic
983750485 4:171262737-171262759 ATATACAAAAGAAATGAGAAGGG - Intergenic
984801215 4:183718722-183718744 ATACCCAAAAGGAGAGTGAATGG - Intergenic
988728584 5:33947644-33947666 ATAGCAAAAAGAAGCGAGAAAGG + Intronic
988729330 5:33954732-33954754 AAGGGCAAAGGGAATGAGAATGG + Intronic
990624147 5:57592809-57592831 ATAGCAAGAAAGAATGAGATAGG - Intergenic
990907775 5:60822201-60822223 ATAGTCAAATGCACTGAGAAAGG + Intronic
991079277 5:62579246-62579268 ATAGCAAAAAATAATGAGTATGG - Intronic
992069667 5:73137053-73137075 ATAGGCAGAAGGAAGGAGAAAGG + Intergenic
993245736 5:85450817-85450839 ATAGAAAAAAAGAATGAAAAAGG - Intergenic
993432232 5:87845950-87845972 ATCACCAAGAGGAATGAGATAGG - Intergenic
993782942 5:92091049-92091071 ATAACCAAAGAGATTGAGAAAGG - Intergenic
993987463 5:94614307-94614329 ATGCCAAAAAGGAAAGAGAAAGG - Intronic
994381506 5:99077316-99077338 ATACCAAAGAAGAATGAGAAAGG - Intergenic
994458105 5:100039769-100039791 ATAAGCAAAAGCAATGAGGAAGG + Intergenic
994551878 5:101244567-101244589 ATGGACAAAAGGGTTGAGAATGG + Intergenic
995371658 5:111425611-111425633 AAAGCTAAAAGGAATTAGCATGG + Intronic
995729336 5:115220972-115220994 ATATTCAAAAGCAAAGAGAAAGG - Intronic
996590697 5:125144037-125144059 ATAGGCAAAAGCAAAGAGGAAGG - Intergenic
997101218 5:130971215-130971237 AAAGACAAAAGAAAAGAGAAAGG + Intergenic
997169819 5:131705748-131705770 ATAACCAAAAGTATTGAAAATGG + Intronic
997402884 5:133616162-133616184 ATAGGCAAAAGGGATGAAAGAGG + Intergenic
997794087 5:136790452-136790474 ATAGCCAAAAGAAAAGAAACTGG + Intergenic
998108903 5:139486299-139486321 TTGGCCAAAAGGAGTGGGAATGG + Intergenic
999142153 5:149369641-149369663 AGGTCCAAAAGGAATGAAAAGGG - Exonic
1000607818 5:163343316-163343338 ATAGACAAAAATACTGAGAAAGG - Intergenic
1001832502 5:174801227-174801249 AGAGGCAAAGGGACTGAGAAAGG - Intergenic
1001883552 5:175267465-175267487 ATACACAAAGGAAATGAGAAGGG + Intergenic
1001993960 5:176140119-176140141 ATATCCAAAAGAAATGAAATCGG - Intergenic
1002193684 5:177491356-177491378 AGTGCCAAAAGGAAGAAGAAAGG + Intronic
1002990119 6:2230733-2230755 AAAGCCAAAAGGAAAAAAAAAGG + Intronic
1003232329 6:4265807-4265829 TTAGCCAAGAAGAAAGAGAAAGG + Intergenic
1004872457 6:19920678-19920700 ACAGGCAAAAGGAATGAGGTGGG - Intergenic
1004892364 6:20113510-20113532 ATTGCCAAAAGGGATGAACAGGG - Intronic
1006415712 6:33902739-33902761 ATCACCAAGAGGAATTAGAATGG + Intergenic
1008163926 6:48112286-48112308 ACATACAAAAGGAAGGAGAATGG + Intergenic
1008280679 6:49592226-49592248 AGAGCCAAGAGGCGTGAGAAGGG + Intergenic
1008406060 6:51119934-51119956 ACAGCAAATAGAAATGAGAAGGG - Intergenic
1008548721 6:52606304-52606326 GTATCCAAAAAGAAAGAGAAGGG - Intergenic
1008830451 6:55753581-55753603 ATAGCAAAAAATAATTAGAATGG - Intergenic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1010161977 6:72867522-72867544 AGAGCCAACAAGAAGGAGAAGGG + Intronic
1010409940 6:75549931-75549953 ATATTCAAAAAGATTGAGAAAGG - Intergenic
1012359937 6:98364839-98364861 ATAGCCTAAAGGTATCAGAGTGG + Intergenic
1012932547 6:105331971-105331993 AAATCCAAAAGGCAGGAGAATGG + Intronic
1012985500 6:105871561-105871583 ATATCAAAAAGGAAAGAGGATGG - Intergenic
1013003364 6:106046826-106046848 CTAGCCAAATGGAAGAAGAAAGG + Intergenic
1013325343 6:109040477-109040499 ATGTACACAAGGAATGAGAATGG - Intronic
1013563930 6:111336678-111336700 ATATCCAAAAGGAATGAAAGAGG + Intronic
1014310890 6:119799939-119799961 ATAAGCAAAGGGAATGAGAAAGG + Intergenic
1015659224 6:135555810-135555832 CTAGCAAAAAGGAAAGAGACGGG + Intergenic
1016528618 6:145033553-145033575 ATAGCCAGCAGGTATGTGAAAGG + Intergenic
1016672278 6:146722736-146722758 ATAGACAGAAGAAATCAGAAAGG + Intronic
1016722387 6:147316502-147316524 ATAGCAAAATGGCATAAGAATGG + Intronic
1016916632 6:149250057-149250079 ATAGCAAAACTCAATGAGAAGGG + Intronic
1016964699 6:149707965-149707987 ATACACAAAAGTAAAGAGAAAGG - Intronic
1017397334 6:154017627-154017649 ATACCCATAAGTTATGAGAAGGG + Intronic
1018501235 6:164412996-164413018 TTAGACAAAAGGAAAGGGAAAGG + Intergenic
1018595246 6:165472332-165472354 ATAGGCATTAGGAATGAGAAAGG - Intronic
1018652236 6:166002268-166002290 AAAGCCAGTGGGAATGAGAAAGG + Intergenic
1019788016 7:2991680-2991702 TTAGAAAAAAGAAATGAGAATGG + Intronic
1019834127 7:3363970-3363992 ATGGCCAAAATGAAAGATAATGG - Intronic
1020903034 7:14029299-14029321 AAAACCAAAAGGAATCAGGAAGG - Intergenic
1021073988 7:16277930-16277952 ATCCACAAAAGGAATGAAAAGGG + Intronic
1021079443 7:16346723-16346745 TTGGCCCAAAGGAATGTGAATGG + Intronic
1021125259 7:16844735-16844757 ATGTCCAAAAGGAAGGAGAAAGG - Intergenic
1022962513 7:35441962-35441984 AAAGCCAAAAGGAAGGGAAATGG - Intergenic
1023760920 7:43464465-43464487 ATAATCAAAAGGCATGAGACTGG + Intronic
1024356571 7:48419334-48419356 ATTTCCAAAAGGAATATGAATGG - Intronic
1024416170 7:49109153-49109175 ATATCCAAAAGGGAAAAGAACGG + Intergenic
1025620917 7:63169990-63170012 GTAGCCAAAAGGAATGAGGAGGG + Intergenic
1025823744 7:64994546-64994568 AGAGGCAAAAGGAAACAGAAAGG - Intronic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1028581554 7:92414365-92414387 ATATCCAGAAGTATTGAGAATGG - Intergenic
1028609548 7:92694844-92694866 ACAGCAAAAAGGAATGACATGGG + Intronic
1028711194 7:93910603-93910625 ATATCCAGAAGGAGTGGGAAGGG + Intronic
1028711549 7:93914800-93914822 ATATCCAGAAGGAGTGGGAAGGG + Intergenic
1029102689 7:98146512-98146534 TAATCCAAAGGGAATGAGAAGGG - Intronic
1029626866 7:101725335-101725357 CTATGCAAAAGGCATGAGAAGGG + Intergenic
1030043787 7:105476299-105476321 ATACCCAAAAGAAATGACAGTGG - Intronic
1030387282 7:108879567-108879589 AAAGTAAAAAGGAAAGAGAATGG + Intergenic
1030429782 7:109430536-109430558 ATAGCTAAAAGGAATTAGTTTGG - Intergenic
1030916207 7:115316941-115316963 ATTGCCAAAACAAATGAGGAAGG + Intergenic
1031052478 7:116957932-116957954 TTTTCCAAAAGGAATGAAAACGG - Intronic
1031448834 7:121888930-121888952 ATAGCTATAAGGAATGATTAAGG + Intronic
1032112591 7:129089166-129089188 AGACCCAAAGGCAATGAGAAAGG - Intergenic
1032297741 7:130657240-130657262 ATATCCATATGGAAGGAGAAAGG - Intronic
1032315227 7:130831569-130831591 ACAACCAAAAGGAAGCAGAAAGG - Intergenic
1032624624 7:133577588-133577610 AGAGCCAAAAGGACTGAACAAGG - Intronic
1032942034 7:136804631-136804653 ATACCCAAAAGAATTGAAAAGGG + Intergenic
1032957519 7:136988237-136988259 GAAGACAAAAGGAAAGAGAAAGG + Intronic
1034054561 7:148021102-148021124 AAAGCCAAAAGGAAAAATAATGG + Intronic
1034061893 7:148099669-148099691 ATAAACAAAAGTAATGAAAAGGG + Intronic
1035416905 7:158696787-158696809 CTAGACAAAAGGAATGGGAAAGG - Intronic
1035919689 8:3663458-3663480 ATAGCCATAGGGACTGTGAAAGG + Intronic
1036170865 8:6483359-6483381 ATAGCCAAAACAATTTAGAAAGG + Intronic
1036476105 8:9094978-9095000 ATGGCACAAAGGAAAGAGAATGG + Intronic
1036546983 8:9781181-9781203 AAAGCAAAAAAGAATGTGAAAGG - Exonic
1038544942 8:28418604-28418626 ATACACAAAAGGACTGAAAACGG - Intronic
1038550790 8:28466717-28466739 AGAGCCAAAAGGAAGGTGAGAGG + Intronic
1038625855 8:29192800-29192822 ATTGCCAAAAAGGAAGAGAAGGG + Intronic
1038939942 8:32293356-32293378 ATAGCTAAAAGGAATGCCAAGGG + Intronic
1039835332 8:41251657-41251679 ATAGCCAAAAGGTAGGCGAGTGG - Intergenic
1040538472 8:48330192-48330214 AGAGCCAAAAGGAAAAAAAAAGG - Intergenic
1041116061 8:54538402-54538424 ATAGTTAAAAAGTATGAGAAAGG - Intergenic
1041183291 8:55271293-55271315 TAAGCTAAAAAGAATGAGAAAGG + Intronic
1041337614 8:56804740-56804762 ATAGCAAAATGGAGAGAGAAGGG + Intergenic
1041427241 8:57736132-57736154 ATAGCCAAACTGAATGAAATTGG - Intergenic
1041500519 8:58534266-58534288 ATAGCCAAGATGAAAGACAAGGG - Intergenic
1041548359 8:59072417-59072439 ATAACCAAAAGACATGGGAAGGG + Intronic
1044424365 8:92034054-92034076 ACAACCAAAAGGGAAGAGAAGGG + Intronic
1044954563 8:97466180-97466202 AAAGCCAGAAAGAAAGAGAAAGG + Intergenic
1045511219 8:102813324-102813346 ATAGCCAACAGGAACAGGAAGGG + Intergenic
1047317159 8:123745374-123745396 GTGGCCAAAAGGAATAAGAAAGG + Intergenic
1047672882 8:127167901-127167923 ATAGCCATAATGAAGAAGAATGG - Intergenic
1048014582 8:130485988-130486010 ATGGCCAATAGGAAGCAGAATGG - Intergenic
1048520098 8:135145940-135145962 AGAGACAGAAGGAAAGAGAATGG - Intergenic
1048803446 8:138216611-138216633 ATTGCCCAAATGAGTGAGAAAGG - Intronic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1049333255 8:142066982-142067004 ATGGCCAACAGGCATGTGAAAGG + Intergenic
1050033881 9:1414706-1414728 ATAGCCAAGAGGCCTGAGATTGG - Intergenic
1050153901 9:2645258-2645280 ATATGCAAAAGGAATGATCAAGG - Intronic
1050279002 9:4031149-4031171 ATACCCAAAAGAATTGAAAATGG + Intronic
1051036361 9:12750945-12750967 AAAGGCAAAAAGAATTAGAATGG - Intergenic
1051304154 9:15690068-15690090 AAAACAAAAAGAAATGAGAATGG + Intronic
1051332723 9:16039898-16039920 ATTGCCAGAAGGAAGGAGATTGG + Intronic
1052465781 9:28828232-28828254 ATTGCCAAATGGTATGAAAAAGG - Intergenic
1054887490 9:70214444-70214466 AAAGCCAGTAGGAATGAGACAGG + Intronic
1055003545 9:71480940-71480962 AAAGCAAACAGGAAGGAGAAGGG - Intergenic
1056890827 9:90490409-90490431 ATACCCAAAAGAACTGAAAATGG + Intergenic
1058007157 9:99929511-99929533 AAGGCCAAAAGGATTAAGAATGG - Intronic
1059672310 9:116503102-116503124 AAAGAAAAAAGGAAGGAGAAAGG + Intronic
1061739264 9:132688125-132688147 ATACACAAAAGGAAAGAGAAGGG + Intronic
1062310809 9:135935724-135935746 ATAACCAAAAGGAATGCAAGTGG + Intronic
1185979465 X:4760543-4760565 AAAGCAAAAATGACTGAGAAAGG - Intergenic
1186034823 X:5411082-5411104 ATAGCCAGAAGGCAAAAGAATGG - Intergenic
1186239715 X:7553345-7553367 AGAGCAAAAAGGAAGGGGAAAGG + Intergenic
1186304877 X:8245555-8245577 AAATCCAAGAGGCATGAGAAGGG + Intergenic
1186787939 X:12970921-12970943 AGAGCCAAAAGAAATGTAAAAGG - Intergenic
1186853483 X:13603150-13603172 AGAGCCAAAAGGGATCAGTAGGG - Intronic
1186911245 X:14168911-14168933 ATAGCCAAAGAGAATGAAACTGG - Intergenic
1188152016 X:26688311-26688333 ATAGGCAAAAGGATTGAACAGGG + Intergenic
1188239882 X:27772930-27772952 ATAGCCAAAATGAAAGAGTGAGG + Intergenic
1188622152 X:32239256-32239278 ATAGCCAAAAGCATGGAAAATGG - Intronic
1189485654 X:41429494-41429516 TTAGTCAAAGGGAAGGAGAAAGG + Intergenic
1189851378 X:45179524-45179546 AGAGACAAAATGAATGAAAAAGG + Intronic
1190037373 X:47038283-47038305 ATACCCAAAAGAAAGGAAAACGG - Intronic
1190549763 X:51567285-51567307 AGAGTCAAAAGGAAAGGGAAGGG + Intergenic
1190783134 X:53618295-53618317 ATATACATTAGGAATGAGAAAGG + Intronic
1191060642 X:56292173-56292195 ATAGCCGAAAGGGATGACATTGG - Intergenic
1191815064 X:65235020-65235042 GTAGCCAAAAAGAATGAACAAGG - Intergenic
1192306634 X:69967234-69967256 ATACACAAAAGGAATGACAGTGG + Intronic
1192729656 X:73790420-73790442 TTAACCAAAAAAAATGAGAAAGG + Intergenic
1192842423 X:74870971-74870993 ATACCCAAAAGAAAGGAAAATGG + Intronic
1193863663 X:86702212-86702234 ATATTCAAAATGAATGATAATGG + Intronic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1194599097 X:95898458-95898480 ATAGCCAAAAGAAAGAAAAAAGG - Intergenic
1195039412 X:101000526-101000548 AATGGCAGAAGGAATGAGAAAGG + Intergenic
1198015408 X:132605336-132605358 AAAGGGAAAAGGCATGAGAAGGG + Intergenic
1198543577 X:137667967-137667989 CCAGCCAAAGGGAATGTGAAAGG - Intergenic
1198948751 X:142044848-142044870 ATATGCTAAAGGACTGAGAACGG - Intergenic
1199013718 X:142787522-142787544 ATAGCCAAAGTGACTCAGAAGGG + Intergenic
1201492152 Y:14553925-14553947 ATAGCCAAAAGGAAAGGACAAGG - Intronic
1202129239 Y:21595192-21595214 ATAGCCAAATGGAACTGGAATGG + Intergenic