ID: 971770753

View in Genome Browser
Species Human (GRCh38)
Location 4:30893703-30893725
Sequence ACTCCTGGTGTTACACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971770753 Original CRISPR ACTCCTGGTGTTACACACAA AGG (reversed) Intronic
903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG + Intronic
905330873 1:37195890-37195912 ACTTCTGGTTATACACCCAAAGG + Intergenic
907174995 1:52512125-52512147 AATCTTGGTATTACACAGAATGG + Intronic
908625455 1:66035843-66035865 ACTACTGGGTGTACACACAAAGG - Intronic
910387089 1:86696146-86696168 ATTCCTGTTGTAAAACACAAAGG + Intergenic
912176996 1:107171563-107171585 TCTCCTGCTGGCACACACAATGG - Intronic
919254577 1:195105042-195105064 GCTCCTGATGTTACTCTCAAGGG + Intergenic
920179718 1:204124943-204124965 ACCCCTGGGGTCACACACAAAGG - Intronic
922236373 1:223725746-223725768 CCTCCTGATGTTTCCCACAAAGG + Intronic
923165008 1:231352298-231352320 CCTCCTGGAATTACACATAAAGG + Intronic
923250944 1:232179187-232179209 ACTCCAGGTCTTACCCACCAAGG - Intergenic
923462415 1:234218784-234218806 ACTGCTGGAATTACATACAATGG - Intronic
1063728059 10:8661591-8661613 ACTCCTGGGCATACACCCAAAGG + Intergenic
1063910654 10:10826354-10826376 ACTCATGGTCTCAGACACAATGG + Intergenic
1066006502 10:31150799-31150821 ACTCCTGGTGTTAAAAAAAGGGG - Intergenic
1069413906 10:68181140-68181162 ACTCCTGTTTTTACTCACAAAGG + Intronic
1069783964 10:70976397-70976419 ACTCCTGGATATACACCCAACGG - Intergenic
1070617469 10:77979798-77979820 AGCCCTGGTGTCACACACAGGGG + Intronic
1076091025 10:127685611-127685633 AGTGCTGCTGTTACACACACTGG - Intergenic
1077719707 11:4615756-4615778 ATTCCTGGTTTGCCACACAAGGG - Intergenic
1082062002 11:47868813-47868835 ACTCCTGGTAATCAACACAAAGG - Intergenic
1084392710 11:68889109-68889131 ACTTCTGGGGCTATACACAAAGG - Intergenic
1087224204 11:95579725-95579747 ACTCCTACTGTTACTCTCAATGG + Intergenic
1092268824 12:7005441-7005463 ATTCCTAGGGTTACACCCAAGGG - Intronic
1093776996 12:23087301-23087323 ACTCCTGCTATCCCACACAATGG + Intergenic
1102376493 12:112425955-112425977 AGTGCTGGGGTTACACACATGGG + Intronic
1105510105 13:21044332-21044354 ACTCCTGGTGTTGCAGTCATAGG - Intronic
1107657564 13:42607104-42607126 ACTCATGGTGTGTTACACAATGG + Exonic
1107831775 13:44380908-44380930 ACTCCTAGGGTAACACAGAATGG + Intronic
1111924031 13:94443772-94443794 CCTCATGGTGGTACACAGAAGGG - Intronic
1119949806 14:78733044-78733066 ACCCCAGGTGTTACAAAGAATGG - Intronic
1121282247 14:92707351-92707373 ACTGCTGGTCTAACACACAGTGG - Intronic
1122003933 14:98686881-98686903 TCTCCTGGTGCTCCCCACAATGG + Intergenic
1124114452 15:26828223-26828245 AGTCCTGGTGTTACAGGAAAGGG - Intronic
1129918780 15:79300074-79300096 ACTCCTGGTCTTAGACACAAAGG + Intergenic
1131764430 15:95659863-95659885 TCTCCTGGTGTTTCCCACAGCGG - Intergenic
1135193441 16:20374449-20374471 ATGCCTGGTGTTGCACATAAAGG + Intronic
1135679278 16:24442982-24443004 ACTCCTGGGGTCACAGACCATGG - Intergenic
1150450747 17:65265633-65265655 ACTCCTGCTGTTATTGACAAAGG + Intergenic
1150878170 17:68993283-68993305 ACTCACAGTGTTACATACAAAGG - Intronic
1156561769 18:38133574-38133596 ACTCCTGGTGTCAGAGACCAAGG - Intergenic
1160063532 18:75553168-75553190 CCTCCCTGTGTTACAGACAAGGG - Intergenic
1163160728 19:15462594-15462616 GCTCCTGGTGGTAAAAACAAGGG - Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
925645598 2:6032757-6032779 CCTCCTGATGTGACACGCAAGGG - Intergenic
926241458 2:11090401-11090423 ACTCCTGGGTATACACCCAACGG + Intergenic
931237874 2:60427055-60427077 ACTCCTTGAGTTCCGCACAAAGG + Intergenic
932918356 2:75881237-75881259 ATTCCTGGGGTTACACATTAAGG + Intergenic
935315570 2:101830350-101830372 TTTCCTGGAGTTACTCACAAGGG + Intronic
936059202 2:109283481-109283503 ACCCCTGGTGTTGTCCACAAAGG + Intronic
942550496 2:177110924-177110946 ACTCCTAGTTATATACACAAGGG + Intergenic
946090675 2:217220140-217220162 AGTCCTGGTTTTACACTAAAGGG - Intergenic
947706957 2:232284078-232284100 AATGCTGGTGTTGCACACAGAGG - Intronic
1168932272 20:1633770-1633792 CCTCCTGGTATTACACAAGAGGG + Intronic
1169682449 20:8230922-8230944 ACTCATTGTGTTAGAGACAAGGG - Intronic
1181402285 22:22657493-22657515 ACTCATGCAGTCACACACAAAGG + Intergenic
1182954819 22:34413741-34413763 ACTTCTGGTTATACACCCAAAGG - Intergenic
949579224 3:5370489-5370511 ACTCATGGAGTTACGCACATAGG - Intergenic
956409487 3:68965026-68965048 CCTCCTAGTTTTACACACCATGG - Intergenic
964077256 3:152706596-152706618 ACTGCTGACGTTAAACACAATGG + Intergenic
968430085 4:551997-552019 AGTCGTGGTGTGTCACACAATGG - Intergenic
971770753 4:30893703-30893725 ACTCCTGGTGTTACACACAAAGG - Intronic
980028539 4:127796458-127796480 ACTCCTGGGCTTATACTCAAGGG + Intronic
980421337 4:132565303-132565325 ACTCCTGGTGTAATGCACCAAGG + Intergenic
986237216 5:5922731-5922753 ACGCCTGATGATACACATAATGG - Intergenic
988833446 5:35009011-35009033 AGTCCTGTTGTTAGAAACAAGGG + Intronic
989274007 5:39565656-39565678 ATTACTGGTGGTACACAGAAGGG - Intergenic
993317765 5:86432912-86432934 GCTCCTGTTGATACAAACAAAGG - Intergenic
996345653 5:122486066-122486088 TCTCCTGGTGGAGCACACAAGGG - Intergenic
1000002560 5:157152810-157152832 ACTCTTGGTGTTATACACTATGG + Intronic
1000601739 5:163283562-163283584 ACACCTGGTCTTTCTCACAAAGG - Intergenic
1007159176 6:39775086-39775108 ACTCCTGGGGATACCCATAAGGG + Intergenic
1008397121 6:51021897-51021919 ACTACTGCTGTTAAAAACAATGG - Intergenic
1010159603 6:72837444-72837466 AGTACAGGTGTTACATACAAAGG - Intronic
1012361172 6:98382416-98382438 ACTCGTGGTGTTTCTTACAATGG + Intergenic
1013448642 6:110256913-110256935 ATTCCTGGTGTTCCACAAGAAGG - Intronic
1013728781 6:113137039-113137061 AATCCTGGTATTTCACACACAGG - Intergenic
1014624656 6:123710853-123710875 ACCCCTGGGGTTACCCATAAGGG - Intergenic
1017387026 6:153898305-153898327 ACTGCTGGCCTTACACACAGAGG + Intergenic
1017673359 6:156788950-156788972 ACTCCTGGTGTTTTACAAAGTGG + Intronic
1018063386 6:160108056-160108078 CCTCCTGGTGACACACACACTGG - Intronic
1021240990 7:18201025-18201047 CCTCCTCGTTTTACACATAAGGG + Intronic
1021420416 7:20440235-20440257 ACTCCAGGTGCTGCCCACAAAGG + Intergenic
1023217867 7:37884683-37884705 ACTTCTGGTGTTCAACTCAATGG - Intronic
1023430456 7:40085680-40085702 CCTCCTGGAGTAACAAACAAAGG - Intronic
1023710736 7:42989819-42989841 AATTCTGGTGTTATACAAAAGGG - Intergenic
1027250715 7:76397297-76397319 ACTCCTTGTGGTACACTCCATGG - Intronic
1028720544 7:94025962-94025984 ACTCCTGATGTTACTTGCAAAGG - Intergenic
1033990602 7:147281083-147281105 ACTCTGGCTGTTACACAGAATGG + Intronic
1035617611 8:1013697-1013719 TGTCCTGGTCATACACACAATGG - Intergenic
1035617668 8:1014115-1014137 TGTCCTGGTCATACACACAATGG - Intergenic
1035617708 8:1014405-1014427 TGTCCTGGTCATACACACAATGG - Intergenic
1035617725 8:1014532-1014554 TGTCCTGGTCATACACACAATGG - Intergenic
1037952183 8:23026786-23026808 ACTCCTGCTGTTACAAGCAAGGG + Intronic
1046362147 8:113173871-113173893 AATCCTGGTGTTCCACCCAAAGG - Exonic
1048214001 8:132479921-132479943 TCTCCGGGTGTTCCACACTAGGG - Intronic
1048848975 8:138626441-138626463 ACCCCTGTTGGTACACACACTGG + Intronic
1048916534 8:139189484-139189506 ACTCCTCATGTTACATAAAATGG + Intergenic
1060819328 9:126652261-126652283 ACTCCTGCTGCTCCACACAGGGG - Intronic
1186831128 X:13391132-13391154 ACTCCTGGTGCTAGGCAGAATGG - Intergenic
1187253996 X:17624654-17624676 AATTCTGGTGTTTCACACCATGG - Intronic
1187306665 X:18101316-18101338 ACTCCTGGTGTTACTGGAAAGGG - Intergenic
1189154997 X:38748099-38748121 ACTACTGGTTATACGCACAAAGG + Intergenic
1190254760 X:48754152-48754174 ACTCCTAGTGTTACACAGACTGG - Intergenic
1190903941 X:54707669-54707691 ACTCCTGGTGGCACACAAAGAGG - Intergenic
1191782880 X:64887153-64887175 ACTCCTAGGCTTATACACAAAGG + Intergenic
1193575925 X:83195041-83195063 ACTACTGGTTTTATACCCAAAGG - Intergenic
1194356807 X:92895814-92895836 ACTACTGTTGATACACACACAGG - Intergenic