ID: 971773901

View in Genome Browser
Species Human (GRCh38)
Location 4:30934874-30934896
Sequence ACATTTCCAGAAAGAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971773899_971773901 10 Left 971773899 4:30934841-30934863 CCAGATATCTTGGGTTCTAGTTC 0: 1
1: 0
2: 2
3: 14
4: 148
Right 971773901 4:30934874-30934896 ACATTTCCAGAAAGAGAACCTGG 0: 1
1: 0
2: 3
3: 32
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971773901 Original CRISPR ACATTTCCAGAAAGAGAACC TGG Intronic
901815441 1:11790989-11791011 ACATTTCCCGGAATAGAACAAGG + Intronic
902461672 1:16582191-16582213 ACATTGCCAAAAAGACAGCCTGG + Intronic
903961849 1:27062930-27062952 ACATTTCCAGAAAAGCAGCCTGG - Intergenic
904703971 1:32376654-32376676 ACATTCCCTGAAGGAGAACCTGG - Exonic
905222291 1:36456730-36456752 GCATTTCCAGGAAGAGCACAAGG - Intronic
905780941 1:40708546-40708568 GCATTTCTAGAAAGTCAACCAGG - Intronic
906889929 1:49699427-49699449 TCATTTAATGAAAGAGAACCAGG - Intronic
907774879 1:57504236-57504258 CCATTTCAATAAAGGGAACCAGG + Intronic
909047575 1:70728526-70728548 TCAGTTCCAGTTAGAGAACCTGG + Intergenic
909221945 1:72975842-72975864 GAATCTCTAGAAAGAGAACCAGG + Intergenic
909613497 1:77579182-77579204 ACATTTTTAGAAAGACAACCAGG + Intronic
910407361 1:86903499-86903521 AGCTTTCCAAAAAGAGAACACGG + Intronic
911834976 1:102606584-102606606 ACATTTACAAACAGAGAAACAGG - Intergenic
913183312 1:116343686-116343708 ACATCTGGAGAAAGAGAAACAGG - Intergenic
913603018 1:120440021-120440043 ACATTGCCAAAAAGACAGCCTGG - Intergenic
913603766 1:120446373-120446395 ACATTGCCAAAAAGACAGCCTGG - Intergenic
913640633 1:120809090-120809112 ACATTGCCAAAAAGACAGCCTGG - Intronic
914211893 1:145587534-145587556 ACATTGCCAAAAAGACAGCCTGG + Intergenic
914264266 1:146024608-146024630 ACAGTTCCCAAAAGAAAACCAGG - Intergenic
914364198 1:146963640-146963662 ACATTGCCAAAAAGACAGCCTGG - Intronic
914486721 1:148117219-148117241 ACATTGCCAAAAAGACAGCCTGG + Intronic
914487484 1:148123500-148123522 ACATTGCCAAAAAGACAGCCTGG + Intronic
914587828 1:149078654-149078676 ACATTGCCAAAAAGACAGCCTGG + Intronic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
915797908 1:158756227-158756249 GCATTTCCAGAAAGGGAATTGGG - Intergenic
916563787 1:165955690-165955712 ACAAATACAGAAAGAGAACATGG - Intergenic
917532237 1:175845802-175845824 ACTTTTCTAGAAACAGAACTTGG - Intergenic
918244369 1:182646054-182646076 ACATTTCCAGAAAGAGTCTTGGG - Intergenic
918524186 1:185447154-185447176 GAATTTCAATAAAGAGAACCTGG + Intergenic
918855167 1:189744186-189744208 ACATTTCCAGATAGACAACTAGG - Intergenic
918869106 1:189944304-189944326 AAATTTGCTGAAAGAGAAGCTGG - Intergenic
921181826 1:212637424-212637446 TAATTTCTAGAAAGAGAACTTGG + Intergenic
921523628 1:216189414-216189436 ACATTTCTTTAAAGATAACCAGG + Intronic
921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG + Intronic
922481656 1:225943510-225943532 TCATTTCCAGACACAGAACAAGG - Intergenic
923470143 1:234282942-234282964 ACAAGACTAGAAAGAGAACCTGG + Intronic
924495741 1:244586721-244586743 ACATTTCCACAAAGCAAATCTGG - Intronic
1063096542 10:2913488-2913510 TCATTCCCAGAAAGAGCTCCGGG - Intergenic
1063218222 10:3943126-3943148 ACAAATCCAGGAAGAGAACCAGG + Intergenic
1063386813 10:5620989-5621011 ACATTTCTACAAAACGAACCCGG + Intergenic
1063578068 10:7279637-7279659 ACCTTCCCAGAAACAGAAACTGG - Intronic
1064456500 10:15492187-15492209 ACATATCCAGAAAGAAATCTGGG - Intergenic
1065852040 10:29798483-29798505 AAATTTCAAGAAAGATAGCCAGG + Intergenic
1066750663 10:38653137-38653159 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
1066966382 10:42269976-42269998 ACAGCTCCAGAAAAAGAAACTGG - Intergenic
1067284961 10:44901088-44901110 AGAGTTCCAGAAACAGAACGGGG - Intergenic
1067921569 10:50463972-50463994 ACATTTACAGAAACAGAAGGTGG + Intronic
1068381259 10:56255856-56255878 ACAGTCCCAGTGAGAGAACCTGG + Intergenic
1070569898 10:77633012-77633034 GCATTTCCATAAAGAGGGCCAGG + Intronic
1072645740 10:97251846-97251868 AAATATCCAGAAAGGGCACCAGG + Intronic
1073918087 10:108429195-108429217 ACACATCCAGAAATAAAACCAGG + Intergenic
1073972938 10:109065088-109065110 ACAGTCCCAGAAAAAGCACCTGG + Intergenic
1074498416 10:114000382-114000404 ACATGTCCTGAGAGAGAACCAGG - Intergenic
1074535000 10:114322464-114322486 AACTTTCCAGACAGAGAACATGG - Intronic
1075289987 10:121220924-121220946 ATCTTTCCAGAAGGAGGACCTGG - Intergenic
1076201834 10:128565400-128565422 ACATTTACATAAATAAAACCAGG - Intergenic
1076274437 10:129184952-129184974 ACTTTTCCAAAAGGAGAACAAGG + Intergenic
1077707125 11:4497540-4497562 ACATTTTCCGAGAGAGACCCAGG + Intergenic
1079275733 11:19035521-19035543 ACATTACTAGAAAGAGCATCTGG + Intergenic
1079350635 11:19689043-19689065 ACATCTCCACAAAGAGCTCCTGG + Intronic
1080258072 11:30315207-30315229 GCATTTTTAGAAAGACAACCTGG + Intergenic
1080856305 11:36114720-36114742 ACATTTCCAGAAAGAAAGGCAGG - Intronic
1082776649 11:57250268-57250290 GTATTTCCAGAAAGAGAAAGAGG - Intergenic
1083711455 11:64551962-64551984 ATATTTTCAGAAAGAAAATCTGG + Intergenic
1088033986 11:105289699-105289721 ACATTTCCACAAAGATGAACAGG + Intergenic
1088319335 11:108539065-108539087 AGATTTCCTGAATGAGAACAGGG + Exonic
1091140124 11:133227680-133227702 GCATTTCCAGACAAAGAAACAGG - Intronic
1091413193 12:257725-257747 ACATTGCCAGACAAAGGACCGGG + Intronic
1092619110 12:10244048-10244070 ACCATTTCAGAAAGAGAAACCGG - Intergenic
1093814579 12:23529320-23529342 ACATTCCCAGAAAGACAGTCAGG - Intergenic
1094759724 12:33516989-33517011 ACATTCTCAGAAAGATTACCTGG + Intergenic
1095561009 12:43564773-43564795 ACTTTTTCAGAAAAAGAACTAGG + Intergenic
1095616436 12:44195253-44195275 CCATTTCCAGAAAGGAAACAGGG - Intronic
1098823431 12:75262525-75262547 AAATTTAAAGAAAGAGAACATGG + Intergenic
1100131264 12:91496569-91496591 AAATTTCCACAAAAAGGACCAGG + Intergenic
1101141268 12:101798191-101798213 ACATTTCCACAAAGAGGAACTGG - Intronic
1102828198 12:115968968-115968990 CCAATTCCAGAAGGAGAGCCTGG + Exonic
1105533952 13:21246522-21246544 ACATCTCCAGGAATAGCACCGGG + Intergenic
1106127886 13:26915411-26915433 ACATTTTCATAAAGAGAATAGGG - Intergenic
1106625674 13:31418646-31418668 ACATATGCAGTAATAGAACCAGG - Intergenic
1108390038 13:49937826-49937848 CCATTTATAGAAAGAGAACCAGG - Intergenic
1108464741 13:50704125-50704147 ACATTTCTAGAAAAGGAATCTGG - Intronic
1108579178 13:51814270-51814292 ACATTTCAAGAAAGAGGCTCTGG - Intergenic
1109063113 13:57645936-57645958 GCATTTCCACAAATAAAACCAGG - Intronic
1109649976 13:65311677-65311699 ACATTGCCAGAATGAGTAACTGG - Intergenic
1110578269 13:77086158-77086180 ACATTTCCAGAATAAAAACTGGG - Intronic
1111106675 13:83654276-83654298 ACATTTTCCAAAGGAGAACCAGG + Intergenic
1111498615 13:89087803-89087825 ACATTTCAAGAAGGAGAAATGGG + Intergenic
1112868507 13:103938791-103938813 ACACTTCTAGAAAGAGAATTTGG - Intergenic
1112992914 13:105535504-105535526 CCCTTTCCAGAAAGAAAACAAGG - Intergenic
1113130298 13:107029117-107029139 TCAGTTCCAGGCAGAGAACCTGG + Intergenic
1113243129 13:108362269-108362291 ACAGTTCCATAAAGGGATCCAGG + Intergenic
1113289675 13:108890803-108890825 ACATTGCCAGAAAGAATGCCAGG - Intronic
1113560681 13:111278159-111278181 ACATTTTCTCAAAGAGAAGCAGG - Intronic
1116678489 14:47936725-47936747 ACATTTCTAGAAAATGAACCAGG + Intergenic
1117830295 14:59743503-59743525 GCATTGCCAGAAAGAGTACAAGG + Intronic
1118221062 14:63854443-63854465 AGCTTTCCAGAAAGACAACTTGG - Intronic
1119605058 14:76008561-76008583 ACATTTCTAGAATTTGAACCCGG + Intronic
1120052106 14:79878775-79878797 ATATATCCAGAAGGAGAAGCAGG + Intergenic
1120653453 14:87161727-87161749 CCATTTCCGGACAGAGGACCCGG - Intergenic
1121032328 14:90669400-90669422 ACATTTCAAGAAAGTGAAGCTGG + Intronic
1121608172 14:95256628-95256650 ACATGACCAGAAAGAAGACCAGG + Intronic
1121832895 14:97066975-97066997 ACTTTTCCAGAATGAGAATAGGG + Intergenic
1121888968 14:97571696-97571718 TCAATTCCAGAAAGATAACAGGG + Intergenic
1123786131 15:23675611-23675633 ACATTCCCTGAAAGAGAAAAAGG + Intergenic
1124221993 15:27857728-27857750 GGATTTCCAGAAAGAGAAGATGG + Intronic
1124803974 15:32862319-32862341 AAAATAACAGAAAGAGAACCTGG - Intronic
1126398785 15:48247799-48247821 ACATTTCCAGAAACACTAACAGG - Intronic
1126550906 15:49928331-49928353 ACATTTCCAAGAAGAGAAGTGGG + Intronic
1127303167 15:57677422-57677444 ACATAGCCAGAATTAGAACCAGG + Intronic
1128220931 15:65968036-65968058 AGATTTGCAGAAAGACAATCTGG - Intronic
1128926080 15:71657500-71657522 ACAACTCCAGAATGAGAACTAGG - Intronic
1129707024 15:77800153-77800175 TCTCTTCCAGAGAGAGAACCAGG + Intronic
1130681269 15:85998972-85998994 AGGTCTTCAGAAAGAGAACCAGG + Intergenic
1130699539 15:86164813-86164835 ACACTTCCAGAAAGAGGACTCGG + Intronic
1131772792 15:95758649-95758671 CCATGTCCAGAAATAGAACATGG - Intergenic
1134492862 16:14708925-14708947 CCATTTGCAGAATGAGAACAGGG - Intronic
1134498243 16:14748047-14748069 CCATTTGCAGAATGAGAACAGGG - Intronic
1134582331 16:15381044-15381066 CCATTTGCAGAATGAGAACAGGG + Intronic
1134871896 16:17659550-17659572 GAATTTCCAGAAAAAGAGCCAGG + Intergenic
1135313651 16:21425095-21425117 CCATTTGCAGAATGAGAACAGGG + Intronic
1135366575 16:21857375-21857397 CCATTTGCAGAATGAGAACAGGG + Exonic
1135445240 16:22513783-22513805 CCATTTGCAGAATGAGAACAGGG - Exonic
1136152789 16:28362819-28362841 CCATTTGCAGAATGAGAACAGGG + Exonic
1136193957 16:28638342-28638364 CCATTTGCAGAATGAGAACAGGG - Exonic
1136210294 16:28752454-28752476 CCATTTGCAGAATGAGAACAGGG - Exonic
1136310313 16:29403799-29403821 CCATTTGCAGAATGAGAACAGGG + Exonic
1136323762 16:29505589-29505611 CCATTTGCAGAATGAGAACAGGG + Exonic
1136438447 16:30245570-30245592 CCATTTGCAGAATGAGAACAGGG + Exonic
1136732060 16:32423948-32423970 ACAGCTCCAGAAAAAGAAACTGG - Intergenic
1139430136 16:66906740-66906762 ACATTTCCAGAGAGGTAACACGG + Intergenic
1139857996 16:69996185-69996207 CCATTTGCAGAATGAGAACAGGG + Intergenic
1141202297 16:81907668-81907690 CCATTTCTAGAAAGTGAAACTGG - Exonic
1141230907 16:82166699-82166721 ACCATCCCAGAAAGAGAATCTGG - Intronic
1142436175 16:90059141-90059163 ACACTTCCTGATGGAGAACCGGG - Intronic
1202994334 16_KI270728v1_random:93296-93318 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
1203021021 16_KI270728v1_random:405638-405660 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
1203039356 16_KI270728v1_random:678796-678818 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
1142864746 17:2783928-2783950 GCATGCCCAGAAAGAGAGCCAGG + Intronic
1144388229 17:14770012-14770034 ACAATTCCAGAAAAAGACCTCGG + Intergenic
1145917590 17:28584809-28584831 TCTTGTCCAGAAAGAGAAGCTGG - Intronic
1147762867 17:42812059-42812081 ACCTTTCCAGGAAGAGTACATGG + Intronic
1147790701 17:43012926-43012948 ACATTTACTGAAAGAAAAGCTGG - Intronic
1148018627 17:44539544-44539566 ACATTTTAAGAAAGAGACCTGGG - Intergenic
1148329587 17:46805786-46805808 ACATCCCCAGGAAGAAAACCTGG + Intronic
1150158511 17:62874191-62874213 ACATTTCAAGAAAGAAAGCAGGG - Intergenic
1152946657 17:83201340-83201362 GCCTGTCCTGAAAGAGAACCAGG + Intergenic
1155354901 18:24942495-24942517 GCATTTCCACAAATAGGACCAGG - Intergenic
1155380517 18:25217503-25217525 ACGTTTCAGGAGAGAGAACCAGG + Intronic
1155488013 18:26368180-26368202 ACATTTTCAAATAGAGAACCAGG + Intronic
1156528200 18:37788489-37788511 ACATATCAAGAAACAGAACATGG - Intergenic
1157171345 18:45409192-45409214 ACATTTTAAGAATGAGAACCTGG - Intronic
1158069295 18:53451820-53451842 ACATGTTTAGAAAGAGAACAGGG + Intronic
1158552679 18:58449844-58449866 ACATTTCATGAAAGAAAGCCAGG + Intergenic
1158895592 18:61909875-61909897 ACATTTCAGGAAAAAGAACAAGG - Intergenic
1159578705 18:70210396-70210418 ACATTTCCAGCAACAGAAAAAGG + Intergenic
1160126093 18:76173404-76173426 ACATTTCCAGAATGACAAATGGG - Intergenic
1163388586 19:17015674-17015696 ATATTTCCAGAAACAGGGCCAGG - Intronic
1163755552 19:19104466-19104488 ACAGAGCCAGAAAGGGAACCTGG + Intronic
1165279992 19:34787810-34787832 ACATATCCAGGAAGAGAAAGGGG + Intergenic
1165990022 19:39805390-39805412 GCATTTCAAGAAAGAGAACCAGG + Intergenic
1166561055 19:43732725-43732747 ACTGTTCCAGAAAAGGAACCTGG + Intronic
1167443376 19:49523075-49523097 ACATTATAAGAAAGAGAACTTGG - Intronic
1167900635 19:52619312-52619334 ACATTTCTATAATGGGAACCAGG - Intronic
1202678109 1_KI270711v1_random:25938-25960 ACATTGCCAAAAAGACAGCCTGG + Intergenic
925482671 2:4293402-4293424 TCATTTCCTGAAAGATAACTCGG - Intergenic
927476243 2:23416489-23416511 ACATTTGCATGAAGAGACCCTGG - Intronic
929003955 2:37377464-37377486 ACATCTCCAGAAAAAGCAGCTGG - Intergenic
930001338 2:46863736-46863758 TCAAATCCAGAAAGAGAACAAGG + Intergenic
930870571 2:56166805-56166827 ACATTTCAAGAAACATGACCAGG + Intergenic
931209607 2:60179928-60179950 ACGTTTGGAGAAAGAGAAGCTGG + Intergenic
931968083 2:67555735-67555757 AATTTTACAGAAAGAGAAACAGG - Intergenic
932209016 2:69911923-69911945 ACAGCTCCAGAAATAGAAGCTGG - Intronic
932499422 2:72170499-72170521 ACATTTCAAGAATGAAAAACCGG + Intergenic
933101124 2:78259026-78259048 ACATTAAAAGAAAGAAAACCAGG - Intergenic
933195056 2:79379825-79379847 TCATTTCCAGAAAGTTAACTAGG - Intronic
934066634 2:88347780-88347802 ACATCTCAAGAGAGAAAACCAGG + Intergenic
934313204 2:91889485-91889507 TCATTTCCAGAAAGGGAAGCTGG - Intergenic
934313667 2:91895292-91895314 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
934713378 2:96529642-96529664 ACAGCTCCAGAAACAGCACCAGG + Intergenic
935078663 2:99770753-99770775 ACATTTCTAGAGAGACACCCTGG - Intronic
935218516 2:100992720-100992742 ACATTTCTCCAAAGAGAACCTGG - Intronic
937053984 2:118915433-118915455 ACATTTCCAGAAGTAGAAAGTGG - Intergenic
937382089 2:121387648-121387670 ACATTTCCTGAAAGAGGACAAGG + Intronic
937432683 2:121852680-121852702 ACAGCTGAAGAAAGAGAACCTGG - Intergenic
938678956 2:133669507-133669529 ACCTTTGAAGAAAGAGGACCTGG - Intergenic
939132317 2:138250937-138250959 AAAAATCCAGAAAGAGACCCAGG + Intergenic
939398276 2:141660129-141660151 TCAATCCCAGCAAGAGAACCTGG - Intronic
939964957 2:148601035-148601057 ACATTTACAGAAAAGTAACCAGG - Intergenic
941766138 2:169298774-169298796 AACTTTCCAGAAGGAGTACCAGG + Intronic
945609629 2:211983347-211983369 ACATTTCCAGAATGATAAATTGG + Intronic
945786351 2:214243129-214243151 ATATTTCCAGACATTGAACCAGG - Intronic
947827361 2:233115453-233115475 GCATTTCCAGAAACAGTTCCTGG - Intronic
1169354090 20:4893423-4893445 ACATATACAGAAAGAGAAGTGGG + Intronic
1169908099 20:10623863-10623885 ACATTTCCAGACAACGAAGCTGG - Exonic
1170060057 20:12249481-12249503 ACCTTTGCACAAAGACAACCAGG - Intergenic
1172119287 20:32588341-32588363 ACTTTTGCAGAAACAGACCCTGG + Intronic
1172809220 20:37635155-37635177 ACGTTACCAGTCAGAGAACCTGG + Intergenic
1173149411 20:40553260-40553282 TCATTCCCAGTGAGAGAACCTGG - Intergenic
1177216655 21:18138677-18138699 GCAGTTCCAGAAAGAGCAGCAGG - Intronic
1177611492 21:23455126-23455148 ACATAGCTAGACAGAGAACCTGG + Intergenic
1177937150 21:27363145-27363167 AAATATTCAGAAAGAAAACCAGG - Intergenic
1178331118 21:31692616-31692638 GTACTTCCAGAAAGAGAACTGGG + Intronic
1178457056 21:32765155-32765177 AGATTCCCAGAAAGAGAATCTGG - Intronic
1179023366 21:37658936-37658958 TCATTTGGAGAAAGAGAACAAGG - Intronic
1179289642 21:40007258-40007280 ACGTTTCCAGGAAGAGGACTGGG - Intergenic
1179557934 21:42192503-42192525 CCACTTCCAAAAAGAGAAACTGG - Intergenic
1179625032 21:42644432-42644454 TCATTTCCAGAAATAGGACTTGG - Intergenic
1180539937 22:16435356-16435378 TCGTTTCCAGAAAGGGAAGCTGG - Intergenic
1180540410 22:16441197-16441219 ACAGCTCCAGAAAAAGAAACTGG + Intergenic
1181387585 22:22557442-22557464 CCATTTCCAGAGAGAAAACAGGG + Exonic
1181567791 22:23750482-23750504 AGATATCAAGAAAGAGAACTTGG - Intronic
1183204285 22:36407932-36407954 GGATTTCAGGAAAGAGAACCTGG - Intergenic
1183477882 22:38046088-38046110 ACATGACCAGGAATAGAACCAGG - Intergenic
949791321 3:7795556-7795578 ACATTTTCAGAAAAAGAAAAAGG - Intergenic
951362321 3:21739831-21739853 ACATTTACTGAAAGTGAACCTGG + Intronic
952421380 3:33134470-33134492 ACATTTCCTGATAGCGAAACGGG + Intronic
952993334 3:38852628-38852650 TCATTTCCAGTAATAGAACAAGG - Intronic
955490419 3:59476633-59476655 AGATTTCAAGCAAGAAAACCTGG + Intergenic
956010764 3:64829204-64829226 ATATCTCCAGAAAGATACCCTGG - Intergenic
956456591 3:69427157-69427179 AGATTTCCAAAAAGTGATCCAGG + Intronic
958032241 3:88125850-88125872 TCATTTCTAGGAAAAGAACCAGG - Intronic
959883635 3:111474152-111474174 TCAGTCCCAGTAAGAGAACCTGG + Intronic
962221661 3:133569475-133569497 TTATTTCCAGAAAGAGAAAAGGG - Intergenic
964329038 3:155580732-155580754 ACATTTCCAGAAAAAAAATACGG + Intronic
964525408 3:157611497-157611519 ACATTTCTAGAAAGAAAAGAGGG + Intronic
964911512 3:161788170-161788192 ACTGTTCCAGAAAGAGAAGGAGG - Intergenic
965440274 3:168704110-168704132 AAATTTCCCTAAAGAAAACCTGG + Intergenic
965476006 3:169155923-169155945 AAATTTCAAGAAAGAGGGCCTGG - Intronic
966032200 3:175363177-175363199 AGAGTTCAAGAAAGAGATCCTGG - Intronic
966974100 3:185069973-185069995 ACATTCCCAGAGTGAGGACCGGG + Intergenic
967119989 3:186374234-186374256 ATCTTTCCAGAAATAGGACCTGG + Intergenic
970918135 4:21359565-21359587 TAATATCCAAAAAGAGAACCAGG - Intronic
971130541 4:23804414-23804436 ACTAGTCCAGAAAGAGAAGCTGG - Intronic
971773901 4:30934874-30934896 ACATTTCCAGAAAGAGAACCTGG + Intronic
972343169 4:38170405-38170427 AAGTTTCCAGAAAGAGCATCTGG - Intergenic
972349545 4:38223992-38224014 ACTTTTCCAGGAAGAGAAACAGG + Intergenic
972784533 4:42314563-42314585 CCAATTCCAGACAGAAAACCAGG - Intergenic
974115660 4:57576244-57576266 ACCTTCCCAGAAGGAGTACCTGG - Intergenic
974913409 4:68149672-68149694 ACAGTCCCAGTGAGAGAACCTGG + Intergenic
975273005 4:72460080-72460102 ACATATTTAGAAAGAGAACCAGG + Intronic
975827971 4:78339540-78339562 ATATTTCCAGAAGAATAACCAGG + Intronic
977945404 4:102907535-102907557 TCGTTTCCAGAAAGGGAAGCTGG - Intronic
977945873 4:102913347-102913369 ACAGCTCCAGAAAAAGAAACTGG + Intronic
978071394 4:104475968-104475990 GCAGTACCAGAAAGAGAACTGGG - Intronic
979133869 4:117084522-117084544 ACATTTCCAGTAAGGGCATCAGG + Exonic
979303736 4:119117943-119117965 AAAGTTTCAGAAGGAGAACCCGG + Intergenic
980216781 4:129862158-129862180 ACACTTCTAGAAAGAGAAGATGG - Intergenic
980279055 4:130694153-130694175 ACAATTCCAGAAAGAAATACAGG - Intergenic
980717207 4:136641754-136641776 ATATTTCCATAAAGTGAACTGGG - Intergenic
981728448 4:147872300-147872322 ACATGTTGAGAATGAGAACCAGG + Intronic
983239045 4:165210166-165210188 ACACTTACACAAAGAGAATCTGG - Exonic
983982421 4:174014945-174014967 AGAGTTCCAGAAAGAGAAAATGG + Intergenic
985331673 4:188844146-188844168 AAATTCACAGAAAGAGAACATGG - Intergenic
985393899 4:189520967-189520989 TCATTTCCATAAAGAGAACTAGG - Intergenic
985614262 5:910199-910221 AAAGTTCCAGAAAGAGAAAAGGG - Intronic
985784592 5:1887159-1887181 ACATTTCCAGGCGGAGCACCTGG + Exonic
986206488 5:5629483-5629505 ACATATTCAGAAAGAGACCATGG - Intergenic
988984562 5:36604450-36604472 AGCTTTCCAGAAAGAGAAAGTGG + Intergenic
989145468 5:38245361-38245383 AGGTTTCCAGAGAGGGAACCTGG - Intergenic
989243551 5:39227861-39227883 ACAATTCTATAAAGAGAATCAGG - Intronic
990208553 5:53456316-53456338 ATATTACCACAAAGAGAAGCTGG + Intergenic
992098687 5:73384890-73384912 ACACTTCTAGAAAGAAAAACAGG + Intergenic
995786798 5:115839491-115839513 ACATTTCCAGAAAGTGAAGCAGG + Intronic
996035512 5:118754175-118754197 ACAATTGCAGAAAGAGCACAAGG + Intergenic
996134670 5:119825639-119825661 ACAAAGCCAGAAATAGAACCTGG + Intergenic
996272599 5:121624966-121624988 AGATTTTCAGAAAGTGCACCAGG + Intergenic
996500405 5:124210075-124210097 ACATTTCCATAAAGCTACCCAGG + Intergenic
997096771 5:130922466-130922488 AGAGTTCCAGAAAGAGAGACAGG + Intergenic
997880890 5:137588653-137588675 ACATTTCCAGGCAGTGAACATGG - Intronic
998979914 5:147690857-147690879 GCATTTCCAGCAACAGATCCAGG - Intronic
999590771 5:153143257-153143279 ACATTTCTAGAGAGAGCCCCAGG + Intergenic
1000274796 5:159724607-159724629 ACTAGGCCAGAAAGAGAACCTGG + Intergenic
1000372566 5:160551022-160551044 ACACTTCTAGAAAGAGAACATGG - Intergenic
1001759944 5:174198970-174198992 CCATTTCCAGAAGGGAAACCTGG - Intronic
1002910093 6:1483640-1483662 ACAGTTCCAGAAAGTGGGCCAGG + Intergenic
1003497404 6:6676378-6676400 ACATTGACAGAAATAGAAACAGG - Intergenic
1003512490 6:6792955-6792977 AAATCTGCAGAAAGAGATCCAGG - Intergenic
1004502859 6:16224620-16224642 ACGTTATCAAAAAGAGAACCCGG - Intergenic
1004829015 6:19457229-19457251 CCATTTTCAGTAAGAGAAACTGG - Intergenic
1004984391 6:21064392-21064414 GCATTTCCAGAAAAAGAAAAGGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005115946 6:22337130-22337152 GCATTTTCAGATAGAGAAACGGG - Intergenic
1006285974 6:33094640-33094662 GCATTTCCAGCAGGAGAAGCAGG + Intergenic
1006291519 6:33141401-33141423 ACATGTCCAGCAGGAGAAGCAGG + Intergenic
1008171957 6:48218920-48218942 ACATTTACAAACAGAGAACAAGG - Intergenic
1008297005 6:49790731-49790753 ACATTTGCATAAAGAAAACCTGG - Intergenic
1008473293 6:51908753-51908775 TCATTTCCAGAAAAAGCACCTGG + Intronic
1008908675 6:56708962-56708984 ACATATCCAAAAAGAGAAAAAGG - Intronic
1012015866 6:93850682-93850704 TCATTTCCATAAAGAAAACCTGG + Intergenic
1012273776 6:97247259-97247281 ACATTTCCAAAAGGAAAGCCTGG + Intronic
1013296752 6:108764552-108764574 ACTTTTGCAAAAGGAGAACCCGG - Intergenic
1014052373 6:116969721-116969743 AGATTTACAGAAAGAGAAAGGGG - Intergenic
1016623913 6:146143955-146143977 AAATTTTCAGAATGAGAGCCAGG - Intronic
1017609197 6:156166604-156166626 ACATTTTCAGAAAAATAACATGG + Intergenic
1017916918 6:158838177-158838199 ACATTTCCACAGAGACAGCCAGG - Intergenic
1018462667 6:164013774-164013796 ACATTTCCAAGAACAGAACATGG - Intergenic
1019657479 7:2203777-2203799 ACATTTCCAGAACGACACACAGG + Intronic
1021358148 7:19679570-19679592 ACATTTTTGGAAAGAGAACATGG + Intergenic
1022474464 7:30700937-30700959 CCATTTCCTGAAATGGAACCTGG - Intronic
1023083424 7:36546662-36546684 ACATGTGCAGAAAGAGACTCTGG - Intronic
1026448094 7:70503069-70503091 ACTTCTCCAGAGGGAGAACCAGG + Intronic
1026540481 7:71275792-71275814 ACATTGGCAGTAAGAGAACCAGG - Intronic
1026548332 7:71344687-71344709 ACATTGCCAGAGAGAGAAGAGGG + Intronic
1027193443 7:76011746-76011768 AGATTTCGAGGAAGAGAACTGGG - Intronic
1028102193 7:86834273-86834295 AGAGTTCCAGAAAGAGAAAATGG - Intronic
1028818590 7:95178979-95179001 ACAATTCCAGATAGAGAAAGAGG + Intronic
1029686758 7:102153723-102153745 ACATTGCCAGAAAGAGCGGCTGG + Intronic
1030418734 7:109280105-109280127 ACAGTTCCAGGCAGACAACCAGG - Intergenic
1031511141 7:122651330-122651352 ACATGTGCAGAAAGAAAACAGGG - Intronic
1032404107 7:131643333-131643355 ACAGAACCACAAAGAGAACCCGG - Intergenic
1032853941 7:135818532-135818554 ACAATTCCAGACAGAGAATAAGG - Intergenic
1033312832 7:140274285-140274307 AGAAATCCAGGAAGAGAACCGGG - Intergenic
1033381932 7:140829712-140829734 ACCTTTTCAGAAAGATAAACTGG - Intronic
1034021936 7:147654036-147654058 AAATTTGCATAAAGAGAACTGGG + Intronic
1034490754 7:151392022-151392044 ACTTTTGCAGAAAGAGCAGCTGG - Intronic
1035595595 8:854910-854932 ACCTTTCCACAAAGAAAATCCGG - Intergenic
1035765515 8:2101867-2101889 ACATTTGGAGAAAGAGAGGCTGG - Intronic
1036920495 8:12849796-12849818 ACTTGTCCAGAAAGACAACAAGG - Intergenic
1037617198 8:20530316-20530338 AGACTTCCAGGAGGAGAACCAGG - Intergenic
1039025482 8:33253257-33253279 TCAGTCCCAGCAAGAGAACCAGG + Intergenic
1041137441 8:54775407-54775429 ACATTCCCAGAAAGCGAGCCAGG - Intergenic
1041963615 8:63648785-63648807 ATATTGCCAAAAAGAGAACGGGG + Intergenic
1042074577 8:64977762-64977784 ATATTTACAGAAATAGAACACGG + Intergenic
1042201933 8:66287077-66287099 CCATTTCCAGAAAGACAGTCTGG + Intergenic
1043365558 8:79529254-79529276 ACATTTTTAAAAAGAGAATCTGG - Intergenic
1043992403 8:86772067-86772089 ACATTTACTAAAAGAGATCCTGG + Intergenic
1045704185 8:104901042-104901064 AACTTTCCAGGGAGAGAACCCGG + Intronic
1046328099 8:112676195-112676217 ACATTTCAGGGCAGAGAACCAGG + Intronic
1046413982 8:113885929-113885951 ACATTTGCAGAAAAGGAAACTGG + Intergenic
1049318346 8:141981620-141981642 AGATATCCAGAAAGAGAACTTGG + Intergenic
1050029556 9:1371190-1371212 GGATTTCCAGAAAGAGAAGTGGG + Intergenic
1050612829 9:7371047-7371069 ACTTTGGCAGGAAGAGAACCAGG + Intergenic
1050844186 9:10193250-10193272 AAATTTTCAGGAAAAGAACCTGG - Intronic
1051004393 9:12325291-12325313 ACATTTCAAGAAAGAAAGCAAGG - Intergenic
1052222995 9:26050189-26050211 TCATCTCCAGAAAGCAAACCAGG + Intergenic
1053546160 9:39025217-39025239 TCATTTACAGTAAGAGAGCCAGG + Intergenic
1053810480 9:41846876-41846898 TCATTTACAGTAAGAGAGCCAGG + Intergenic
1054620113 9:67340563-67340585 TCATTTACAGTAAGAGAGCCAGG - Intergenic
1056364870 9:85894169-85894191 AGAATTCCAGAAAAAGAACTAGG - Intergenic
1056873236 9:90304444-90304466 ACATTTCCCGAGAGAGAACCAGG - Intergenic
1057336436 9:94159264-94159286 ACATTTCCAGGAAGGGACACTGG + Intergenic
1060437319 9:123605154-123605176 ACAGTTCCAGACAGAGGATCCGG - Intronic
1061339620 9:129968933-129968955 ATAGCTCCAGAAGGAGAACCAGG - Intronic
1188329443 X:28850691-28850713 GCTTTTCCAGGAGGAGAACCTGG + Intronic
1188674136 X:32917759-32917781 TCATTTCCAGAAAGACAATATGG + Intronic
1189173637 X:38932791-38932813 TCATTACCAAAAAGAGAACCAGG - Intergenic
1190401354 X:50038846-50038868 ACATTTCCAGGAAGAGGTCCAGG + Intronic
1190899817 X:54659922-54659944 AGATTTCCAGAAAGAGAAAGGGG - Intergenic
1191034289 X:56008328-56008350 TCAGTCCCAGCAAGAGAACCTGG - Intergenic
1192502366 X:71662463-71662485 ACAGCTCCAGAAAGAGGACGGGG + Intergenic
1194491761 X:94559649-94559671 AAACTTCCAAAAAGAGAACAAGG - Intergenic
1195099159 X:101537805-101537827 GCTTTTCCAGACAGAGAACGTGG + Intergenic
1198175669 X:134152031-134152053 ACATTTCAAGAAGGAGAAAATGG - Intergenic
1198500339 X:137238381-137238403 ATACTTCCTGAAAGAGAACCAGG - Intergenic
1200275636 X:154729781-154729803 AACTTTCCAGAAAAAGAAACTGG + Intronic
1201181138 Y:11346994-11347016 TCTTTTCCAGAAAGGGAAGCTGG - Intergenic
1201492910 Y:14562169-14562191 AAAATTCCTGAAAGAAAACCTGG - Intronic
1201728463 Y:17180952-17180974 ATACTTCCAGAAAGAGAAGTAGG + Intergenic