ID: 971775128

View in Genome Browser
Species Human (GRCh38)
Location 4:30953546-30953568
Sequence ATTTCATTTGAACACCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971775127_971775128 22 Left 971775127 4:30953501-30953523 CCACAGTTTATGTTCTTATATTT No data
Right 971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG 0: 1
1: 0
2: 1
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971775128 Original CRISPR ATTTCATTTGAACACCTTCA AGG Intronic