ID: 971775128

View in Genome Browser
Species Human (GRCh38)
Location 4:30953546-30953568
Sequence ATTTCATTTGAACACCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971775127_971775128 22 Left 971775127 4:30953501-30953523 CCACAGTTTATGTTCTTATATTT 0: 1
1: 0
2: 7
3: 86
4: 911
Right 971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG 0: 1
1: 0
2: 1
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971775128 Original CRISPR ATTTCATTTGAACACCTTCA AGG Intronic
901369997 1:8788928-8788950 ATTTCATTTGGAAAGCCTCAGGG - Intronic
902860656 1:19242934-19242956 CTATCATTTGAACAACTTTAGGG + Intronic
903534601 1:24058485-24058507 ATTTCATGTGATTACCTTGATGG + Intronic
903552158 1:24165217-24165239 ATTTTATTTGGAAACCTTCTCGG + Intronic
904506394 1:30958903-30958925 ATTTTATATGTACACATTCATGG + Intronic
904912116 1:33942903-33942925 TTCTCATTTGAAGACCCTCATGG + Intronic
907479211 1:54732775-54732797 ATTTTCTTTAAACAGCTTCAAGG - Intronic
907633070 1:56104318-56104340 ATGTCAATTGAAAACCTTCTGGG - Intergenic
908260228 1:62334596-62334618 AGTTCATATGATCACCTACAGGG + Intergenic
908968769 1:69799213-69799235 ATTTTATTTGTATACCTTTAAGG + Intronic
909151085 1:72006267-72006289 ATGTCATTTTAACACATTCTTGG - Intronic
911769132 1:101716771-101716793 ATTTCATTTGAAGTCCTCAAAGG - Intergenic
911964143 1:104344516-104344538 ATTTCATTTACACTCCTTCATGG + Intergenic
912003526 1:104864174-104864196 ATTTTATTTCAATACCTTTAGGG + Intergenic
913541858 1:119828818-119828840 ATTTTGTTTGACCATCTTCAAGG - Intergenic
915171951 1:153984322-153984344 ATACCACTTAAACACCTTCAGGG + Intronic
917805168 1:178606778-178606800 ATCTCACTTAAACCCCTTCAAGG + Intergenic
918281401 1:183009741-183009763 ATGACATTTGAACATTTTCATGG - Intergenic
920112992 1:203600175-203600197 ATTTCATTTGTAAACTGTCATGG + Intergenic
920766652 1:208840088-208840110 ATTTCTTTGGGACATCTTCATGG - Intergenic
920965878 1:210700133-210700155 ATGTCTTTTGAACACCATCTTGG - Intronic
922811842 1:228420439-228420461 ATTTCATTTGTACATGTACATGG + Intergenic
923136381 1:231123831-231123853 GATTCATGTGAACACCATCATGG + Intergenic
1063501414 10:6558293-6558315 AGTTCTTTTGAACAATTTCAAGG - Intronic
1065043816 10:21726427-21726449 ATTTTATTTGAAAACATGCAGGG + Intronic
1067381760 10:45780507-45780529 ATTTCATTTTCTCACCTACATGG - Intronic
1067759106 10:49029938-49029960 ATCTCACTGGAACACCTCCAGGG + Intronic
1067889460 10:50121144-50121166 ATTTCATTTTCTCACCTACATGG - Intronic
1068061315 10:52071335-52071357 AGTTCATGTGAACACCATCATGG - Intronic
1068634384 10:59332371-59332393 ATTTCATTTTAAAACATTTAAGG + Intronic
1069252257 10:66283570-66283592 ATTTCATTTTAACTCCTCTAAGG + Intronic
1069317761 10:67128717-67128739 TTTTCATGTGGACACCTTCTGGG - Intronic
1069962180 10:72085715-72085737 ATTTCGTTTGAACCCCTTAAGGG - Intronic
1074155351 10:110793926-110793948 ATTACCTTTGAAGACCTTTAAGG + Intronic
1078965774 11:16339833-16339855 TGTTCATTTTAACACCTCCAAGG - Intronic
1078973395 11:16442468-16442490 ATGTCATTTTAATAGCTTCAGGG - Intronic
1080916244 11:36663304-36663326 ATTTCATTCGAAGACTTTAAGGG - Intergenic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1085048320 11:73366087-73366109 ATTTCATTTGGACACTTCCGTGG - Intronic
1086308922 11:85513991-85514013 TTTTCTCTTGAACACCTTCTGGG + Intronic
1087237233 11:95733503-95733525 AGAGCATATGAACACCTTCAGGG - Intergenic
1092690056 12:11098903-11098925 ATTTCATCTGGACAACTTCTTGG - Intronic
1094688555 12:32745804-32745826 ATTTCTTTTGAAAACCTTACAGG - Intronic
1095649128 12:44585991-44586013 ATTTCATTTGAACAGCATATGGG - Intronic
1096141089 12:49243133-49243155 ATTTCATCTTAACAAATTCACGG - Intronic
1099080908 12:78179188-78179210 ATTTCATTCCAACATTTTCAAGG - Intronic
1099164905 12:79292888-79292910 TTTTCATTTGAAGACATTCCAGG + Intronic
1099414054 12:82365525-82365547 ATTTCATTATAGCTCCTTCAAGG + Intronic
1100112023 12:91257126-91257148 TTATCAGTTGAACACCTGCAAGG + Intergenic
1103135727 12:118505915-118505937 ACTTCATGTGAACATATTCAGGG - Intergenic
1104759999 12:131291721-131291743 ATTTTATTTGTACAAATTCATGG - Intergenic
1105432301 13:20347982-20348004 ATGGCATTTGAACCTCTTCATGG - Intergenic
1105727130 13:23174859-23174881 ATTCCATTTGAAAACCATAATGG - Intergenic
1105980971 13:25515818-25515840 ATTTCAGTTAGACACCTGCAGGG + Intronic
1107271427 13:38622348-38622370 ATTTTATGTGAATAACTTCATGG + Intergenic
1107401058 13:40069600-40069622 ATTTCATTAGACCATTTTCATGG + Intergenic
1107965940 13:45598378-45598400 ATGTCATTTTTAAACCTTCAGGG - Intronic
1108209171 13:48121012-48121034 GTTTCTTTCGAATACCTTCAAGG + Intergenic
1108889530 13:55236598-55236620 ATTTCATTTTAAAACTGTCAGGG - Intergenic
1109254221 13:60059003-60059025 ATTTTATTTCAACAGCTTTAGGG - Intronic
1111329785 13:86749782-86749804 ATTTGATTTTAACATCTTCCTGG - Intergenic
1111384853 13:87511956-87511978 ATTGAATTTGAACACTATCAAGG - Intergenic
1111629690 13:90834192-90834214 TTATAATTTGAACACCATCATGG - Intergenic
1112212683 13:97396163-97396185 ATTTCATGTGAACAACTATATGG - Intergenic
1112561143 13:100515381-100515403 ATTTCATTTAAACTCATTTATGG + Intronic
1114430338 14:22655387-22655409 ATCTCATTTGTAAACCGTCATGG - Intergenic
1114544410 14:23487932-23487954 ATTTCTTTAGAAGACATTCAAGG - Intronic
1114965506 14:27954679-27954701 ATTCCATTGGATCACCATCATGG - Intergenic
1116070900 14:40044199-40044221 ATTTCATTTAAATACGTTCCAGG + Intergenic
1117910051 14:60628250-60628272 ATTTCATATTAACACTTTTATGG + Intergenic
1118767113 14:68917240-68917262 CCTTCATGTGCACACCTTCAGGG + Intronic
1120617023 14:86719553-86719575 ATTTTATTTGAACACCAAGATGG - Intergenic
1121808144 14:96850858-96850880 ATTTCCTTTGAACATCTTGTTGG + Intronic
1125363545 15:38889612-38889634 GCTTCTTTTGAACATCTTCAGGG - Intergenic
1126926041 15:53587588-53587610 ATTTCATTTTAAGATTTTCAAGG + Intronic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1127627159 15:60790890-60790912 TTTTCCTTTCAACACCATCATGG + Intronic
1127697356 15:61463368-61463390 ATTAGATTTGAACAACATCAGGG - Intergenic
1131152472 15:90055708-90055730 ATCTCCTGTGCACACCTTCATGG + Intronic
1131516930 15:93085213-93085235 ATTTCATTTTTTCATCTTCATGG - Intronic
1131563162 15:93461970-93461992 ATTTCATATGAACAACTTTAGGG - Intergenic
1131997768 15:98148213-98148235 ATTTCAGTTTCACCCCTTCAAGG + Intergenic
1132001352 15:98183586-98183608 TTTGTATTTGAACACTTTCATGG - Intergenic
1136639830 16:31554245-31554267 CTTTGGTTTGAACAACTTCAAGG + Intergenic
1136950331 16:34709873-34709895 ATTGCATTTGATTCCCTTCATGG + Intergenic
1138144404 16:54595794-54595816 CTCTCATCTGAACACCTTCAAGG + Intergenic
1139026169 16:62821001-62821023 ATTTCATTTGAATAACTTGCAGG - Intergenic
1139809726 16:69604308-69604330 AATTCAATTGAGCACCTACAAGG - Intronic
1143617036 17:8058233-8058255 ATTACATTTGAACAACTTCTAGG + Intergenic
1143970938 17:10795195-10795217 CTTTCATTTGATGACCTTAAGGG - Intergenic
1147018938 17:37515443-37515465 AATTCCCTTTAACACCTTCAAGG - Exonic
1149056691 17:52375431-52375453 ATTTCATTTTAAAAGCTTTATGG - Intergenic
1151087770 17:71400891-71400913 ATTTTCTTTCAAAACCTTCAAGG + Intergenic
1203187911 17_KI270729v1_random:145652-145674 ATTTCATTTGATTACATTCGAGG + Intergenic
1153473837 18:5475248-5475270 AATTTATTTGAACACTTTCTGGG - Intronic
1153552700 18:6278802-6278824 AATTAATTTGAACACCTGGAAGG - Intronic
1153616171 18:6936311-6936333 TTTTCTTCTGACCACCTTCAGGG + Intergenic
1157070247 18:44398896-44398918 ATTTCAGTTGATCAATTTCAGGG + Intergenic
1157634240 18:49133993-49134015 ATCTCATTTTAATAGCTTCATGG - Intronic
1158191590 18:54834758-54834780 ATTTCATTTTAAAACGTTTAGGG + Intronic
1158368220 18:56765362-56765384 ATTCCATTTGATCTCCTTTATGG + Intronic
1158387407 18:57011461-57011483 ATATCATTTTAACATCTTAATGG - Intronic
1158640833 18:59202285-59202307 ACTTCATTTGCACAGCTACAAGG - Intergenic
1158903621 18:61989235-61989257 ATATTATTTAAACACATTCAAGG + Intergenic
1159107871 18:64024534-64024556 ATTTCATTTTAACATGCTCAGGG + Intergenic
1160030600 18:75255283-75255305 TTTTCATTTTCACACCTCCATGG + Intronic
1160281067 18:77491469-77491491 ATTTTATTTTAACATTTTCAGGG - Intergenic
1163135302 19:15306614-15306636 CTTTCATCTGAACACTTTAAAGG + Intronic
1163328016 19:16617796-16617818 ATTTCATTTTCTCACCTTGATGG - Intronic
1165693200 19:37879987-37880009 ATTTAATTTGAAGAGTTTCATGG + Intergenic
1166018782 19:40005624-40005646 GTTTCATTTGAAAACATTCTGGG + Intronic
926571916 2:14538252-14538274 ATTGCTTTTGAAATCCTTCAAGG - Intergenic
926997891 2:18758153-18758175 ATATCATTTGAACACATTTTTGG + Intergenic
929654229 2:43714517-43714539 ATTGCATTTGAATACCTTGGAGG + Intronic
929829680 2:45336679-45336701 ATTTCTTTTAAACACATTGAAGG - Intergenic
929885816 2:45877136-45877158 ATTTCCTTTGAGCACCTTAAAGG + Intronic
930480604 2:51943845-51943867 TTTTCATTTGTGCACCTACAGGG - Intergenic
931851667 2:66257855-66257877 ATTTCTTCTGAAAACTTTCAGGG + Intergenic
932822019 2:74909488-74909510 AGTTCCTTTGACCCCCTTCATGG - Intergenic
933292611 2:80454534-80454556 CTAACATTTGAACACGTTCAAGG - Intronic
933858781 2:86443319-86443341 TGTTCATTTGAACACTTTCAGGG + Intronic
936610307 2:113996140-113996162 ATTCCATTTGTAGTCCTTCATGG + Intergenic
936893040 2:117394536-117394558 ATTTTATTGGAACATTTTCATGG - Intergenic
937189955 2:120085687-120085709 ACTTGAGTTGAACACCTTTACGG + Intronic
937400285 2:121576644-121576666 ATTTCATTTGAGCATATTCTTGG - Intronic
937448740 2:121982414-121982436 ATTTCATTTGCTGACCTTGAAGG + Intergenic
938337744 2:130514159-130514181 TTTTCATTTGTACACATTCATGG + Intergenic
938352095 2:130606576-130606598 TTTTCATTTGTACACATTCATGG - Intergenic
938601599 2:132847656-132847678 ATTTTCCGTGAACACCTTCAAGG + Intronic
939200002 2:139021899-139021921 AATTCATTTTAGCACTTTCATGG - Intergenic
940102243 2:150054639-150054661 ATTTTTTTTGAATACCTTCTAGG - Intergenic
940111565 2:150160589-150160611 ATTTCATTTCTGTACCTTCATGG - Intergenic
941467881 2:165852210-165852232 ATTTAATTTGTTCACATTCAAGG + Intergenic
941540210 2:166772736-166772758 AGTTCATTTGAAGACCTTTCTGG + Intergenic
941947308 2:171113853-171113875 ATTTAATTAGAATACCATCAAGG + Intronic
942870217 2:180725730-180725752 ATTTCATTTGTAAACTGTCATGG + Intergenic
943401738 2:187420913-187420935 ATTTCCTTTGAACACACTAAAGG + Intronic
943447227 2:188002193-188002215 ATTTTATTTCAATAGCTTCAAGG - Intergenic
943990662 2:194687021-194687043 ATTTTATTTGAAAAACTTCTTGG - Intergenic
945647943 2:212523919-212523941 ATTTCAGTTAAACACCATCAAGG - Intronic
946749351 2:222877974-222877996 GTTTCTTTTGAGCTCCTTCAGGG + Intronic
946822473 2:223644377-223644399 ATTTCCTTTGGACACATGCAGGG - Intergenic
947772171 2:232679135-232679157 ATTTCCTTTTAATACCTTTATGG - Intronic
947857191 2:233332053-233332075 AGTTCATTTGACCATCTTCTGGG - Intronic
948090783 2:235293070-235293092 GTTTCATTTGAACAGCGACAAGG - Intergenic
1168787391 20:551754-551776 ATTTCCTCTGAGCACCTGCATGG - Intergenic
1169402442 20:5294455-5294477 ATTTCTCTAGAACACCTGCAGGG + Intergenic
1170237680 20:14125824-14125846 ATTTCTTTTGAACAACTCCAGGG - Intronic
1170337765 20:15289622-15289644 ATTTCATTTGATCACATGAAGGG - Intronic
1170414458 20:16125165-16125187 ATTTCTTCTGAAAATCTTCATGG + Intergenic
1170871335 20:20209324-20209346 ATTTCCTTTGAACAAATTCCTGG + Intronic
1172196155 20:33093078-33093100 TTTTCTTTTGAAAACTTTCAAGG + Intronic
1172613753 20:36269833-36269855 ATTTCCTTAGGACACCTTCCTGG + Intronic
1173303957 20:41830298-41830320 ATTTCATTAAAACACCCACACGG + Intergenic
1173368560 20:42413150-42413172 ATTTTATTTGAAAACCTGGATGG + Intronic
1173456019 20:43201936-43201958 ATTTCATTTTAAAACATTAACGG - Intergenic
1173906936 20:46636376-46636398 ATTTCAATTGAGTACCTTCTAGG - Intronic
1174866418 20:54140744-54140766 AATTCATTTGAATACATTGATGG - Intergenic
1174878942 20:54256102-54256124 CGTTCATTTATACACCTTCATGG - Intergenic
1176923135 21:14713495-14713517 ATTTTATTTGAAGCCATTCAAGG + Intergenic
1178616732 21:34141124-34141146 ATTTCATGCTAACACCATCACGG + Intronic
1178808647 21:35860695-35860717 ACTTCCTCTAAACACCTTCATGG - Intronic
1180558881 22:16600262-16600284 TAGTCATTTGAATACCTTCAGGG - Intergenic
1183751027 22:39720394-39720416 ATTTCATTTGATCCCCAACAAGG - Intergenic
949641678 3:6042788-6042810 ATATCATTTGAAAACTTTCCAGG - Intergenic
951269314 3:20605499-20605521 ATTTCATTAACACACCCTCAGGG + Intergenic
951696272 3:25448765-25448787 ATTTCATTTGAAAAGATTCTCGG - Intronic
951748346 3:26004958-26004980 ATGTCATTTGAACAGCTTTTAGG - Intergenic
951801371 3:26600014-26600036 ATATCACTGGAACACATTCAAGG - Intergenic
951902224 3:27668062-27668084 TTTTCATTGTAACACCATCATGG - Intergenic
952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG + Intergenic
953294771 3:41703969-41703991 AGTTGATTTTGACACCTTCATGG - Intronic
954313897 3:49790780-49790802 ATTTCTTTTTCACACCATCATGG - Exonic
955457081 3:59134992-59135014 ATTGTATTTGAAGAACTTCATGG + Intergenic
956513444 3:70019814-70019836 ATTCCATATTAACACATTCAAGG + Intergenic
956769760 3:72515160-72515182 ATTTTATTTTAAAACATTCAAGG - Intergenic
956864667 3:73357137-73357159 ATTTCTTTGGAAAACCTCCATGG + Intergenic
957180653 3:76873759-76873781 ATTTCATGAGAAAACTTTCAGGG - Intronic
957229156 3:77489427-77489449 AGTTCATTTGAACAGCAGCAGGG + Intronic
957518398 3:81286535-81286557 ATGGCATTTGTAAACCTTCATGG - Intergenic
958050981 3:88345799-88345821 CTTTCATTTGAACACTTTAGAGG - Intergenic
958091945 3:88887759-88887781 ATTTGATTTGAACACTTTACAGG - Intergenic
958509243 3:95023965-95023987 AATTCAATTGAAAACCTTCCAGG + Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
960042417 3:113164012-113164034 ATTTCATTTGAACAACTTTCTGG - Intergenic
960369899 3:116822259-116822281 ATTGCTTCTGAACACCCTCAGGG + Intronic
961438814 3:126938596-126938618 ATTTCATTTTAAAACCTTATTGG - Intronic
962685858 3:137847056-137847078 TTTTCATGTGAGCTCCTTCAGGG + Intergenic
962748429 3:138415161-138415183 ATTTCCTTTGAATACCTTTAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965969954 3:174542713-174542735 ATTTCATTTGTAAACTGTCATGG + Intronic
966158740 3:176946227-176946249 ATTTCATTAGAAAAGTTTCAGGG + Intergenic
967503320 3:190224496-190224518 ATTTCACTTGTACATCTTTAAGG - Intergenic
968759704 4:2436328-2436350 CATTCATTTGAAAACCTTTATGG + Intronic
971021336 4:22539169-22539191 CTTTCAGTTGAACATCTTGAGGG - Intergenic
971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG + Intronic
971943389 4:33243421-33243443 ATTTCCTTTGAATACCTCAATGG + Intergenic
972052470 4:34755847-34755869 ATTTCTTTTCAACACCTGGAGGG + Intergenic
973741899 4:53926449-53926471 ATGGCATTTGATGACCTTCATGG - Intronic
975565595 4:75751025-75751047 AATTCTTTTGAATACCTACATGG + Intronic
976094728 4:81496285-81496307 ATTTCATTTGAAGACCCCTATGG - Intronic
976863767 4:89699334-89699356 ATTTCATTAGTACACTTTCTGGG + Intergenic
977683480 4:99820795-99820817 GTTTTGTTTGAACACCATCACGG - Intronic
978479561 4:109173925-109173947 ATTTCCTTTGAGCATCATCATGG + Intronic
978594543 4:110362579-110362601 ACTTCATTTCATCATCTTCAAGG - Intergenic
980403076 4:132319074-132319096 AATTTATTTTAACACATTCATGG + Intergenic
982055894 4:151548591-151548613 ATTTCATTTGCAAACTGTCATGG - Intronic
983837760 4:172413471-172413493 ATTTATTTTGAAAACCTACAGGG - Intronic
984030186 4:174594724-174594746 AATTTATTTGAACATTTTCATGG + Intergenic
984414976 4:179446502-179446524 AATACATTTAAACACCTTGAGGG + Intergenic
985001785 4:185492237-185492259 ATTCCATCTAATCACCTTCAAGG + Intergenic
985084990 4:186303987-186304009 AGTGCACTTGAACACCTTTATGG + Intergenic
986133431 5:4951963-4951985 ATATCCCTTGCACACCTTCAGGG + Intergenic
987169154 5:15235404-15235426 CTATCTTTTGAACACATTCATGG + Intergenic
987918146 5:24242809-24242831 ATTTCATGTGAATATCTTCTGGG + Intergenic
989497777 5:42129342-42129364 ATTTCATTTTCTCACTTTCATGG + Intergenic
989809515 5:45656717-45656739 ATTTTATTTGATCACATTCTTGG - Intronic
990396846 5:55390872-55390894 ATTTCCATAGAACATCTTCAAGG - Intronic
990990776 5:61681590-61681612 ATTTCATGTGACCACATTCTGGG - Intronic
991249397 5:64543381-64543403 ATTTAGTTTCAACACTTTCATGG - Intronic
991679965 5:69129273-69129295 ATTTCCTTTTAACACCATCTTGG + Intronic
994537855 5:101054455-101054477 ATTACATTTGCACAACTTTAAGG - Intergenic
995660138 5:114472599-114472621 ATTGCAGTTGATCACCTTGAAGG + Intronic
996300680 5:121980553-121980575 AATTTTTTTGAACACCATCAAGG + Intronic
997138822 5:131356373-131356395 TTTACATATAAACACCTTCAAGG - Intronic
998061676 5:139123639-139123661 ATTTCATTGACACACCTCCAAGG - Intronic
998863670 5:146472656-146472678 CTTTCACTTGAACACTTTGAGGG - Intronic
999018348 5:148134321-148134343 ATTTCATTTAAACTCCTGAAAGG + Intronic
1000398498 5:160800890-160800912 CTTTCATTTGAAGCCCTGCAGGG + Intronic
1000578930 5:163011383-163011405 ATTCCATTTAGACACATTCAGGG + Intergenic
1000750254 5:165086556-165086578 ACTTGATTTAAACAGCTTCATGG - Intergenic
1003212676 6:4081038-4081060 CTTTCTTTTCAACACCTTGAAGG + Intronic
1003976021 6:11345484-11345506 GCTACATTTGAACACCTTAAAGG + Intronic
1004805997 6:19204756-19204778 ATCTTATTTGATGACCTTCAGGG + Intergenic
1005147127 6:22704301-22704323 AGGTCTTTTGAACTCCTTCAGGG + Intergenic
1005667198 6:28070007-28070029 AGTTCATTTGAAAACTTTCTGGG + Intergenic
1006199647 6:32276728-32276750 ATGGCATTTGAAAACCGTCATGG + Intergenic
1006279598 6:33039381-33039403 ATTATATTTGAACATATTCATGG + Intergenic
1007808707 6:44471134-44471156 ATGTCCTTTGATCATCTTCAGGG - Intergenic
1008567012 6:52778467-52778489 ATTTCATTTGAACAGTTGCCAGG - Intergenic
1008570561 6:52812535-52812557 ATTTCATTTGAACAGTTGCCAGG - Intergenic
1010327199 6:74578128-74578150 ATTTCATTGGCATACCTTCAGGG + Intergenic
1010430077 6:75768685-75768707 AATTCATTTTAATACCTTCAAGG + Intronic
1010632800 6:78218925-78218947 AGTTTATTTGAACACCTTTGAGG + Intergenic
1010792618 6:80082001-80082023 ATTTCATTAGAAAAATTTCAGGG - Intergenic
1011048298 6:83112072-83112094 ATTTCTTTTGAATAACTTAATGG + Intronic
1011888048 6:92122378-92122400 ATTTCATTAGAAGGCCTCCATGG + Intergenic
1013457875 6:110348138-110348160 TTTCCATGTGAACACCTGCAAGG + Intronic
1014181143 6:118385580-118385602 AATTCATTTAAATGCCTTCATGG + Intergenic
1014263172 6:119243867-119243889 ATTTCCTATACACACCTTCATGG + Intronic
1014515499 6:122373782-122373804 ATTTCAACTCAACACATTCAGGG + Intergenic
1014544567 6:122718508-122718530 CTTTCATTTAAAAACCCTCATGG + Intronic
1016634291 6:146269764-146269786 GTTTCATCTGAAAACCTCCATGG + Intronic
1016672627 6:146726678-146726700 ATTTCACTTGTATACCTACAGGG - Intronic
1022835513 7:34110028-34110050 ACTTCATTTGAAAACTTTCTAGG - Intronic
1023248710 7:38234679-38234701 AATACATTTGAACACTTACATGG - Intergenic
1023713272 7:43017200-43017222 ATGTCAATTGAACGCCTTCTTGG - Intergenic
1024109565 7:46131507-46131529 ATTTCCTTTGAGCATCATCATGG - Intergenic
1025475866 7:60920242-60920264 ATTTCATTTGAGTCCATTCAAGG + Intergenic
1025483652 7:61018849-61018871 ATTCCATTTGATTACATTCAAGG + Intergenic
1025875460 7:65476839-65476861 ATTCGATTTTAACACCCTCAGGG + Intergenic
1026436759 7:70406031-70406053 TTTTCTTTTAAATACCTTCAGGG - Intronic
1028519527 7:91714822-91714844 TTTTTATTTGTACACCTTTATGG - Intronic
1028853115 7:95558806-95558828 ATTTCATTTGGATACCTTCAGGG - Intergenic
1029841439 7:103368056-103368078 TTTTCACTTGAAAGCCTTCAGGG - Exonic
1031382837 7:121109849-121109871 ATTTCATTTTCATGCCTTCAAGG + Intronic
1031518263 7:122728752-122728774 ATTATATTTGTACACATTCATGG + Intronic
1034618433 7:152437741-152437763 TAGTCATTTGAATACCTTCAGGG + Intergenic
1037066630 8:14587329-14587351 ATTTCATATTAACACATTCGTGG - Intronic
1039470364 8:37809681-37809703 ATCTCATTTCAAGACTTTCAGGG + Intronic
1040847673 8:51861148-51861170 ATTTGATTTGAATACTATCATGG - Exonic
1041355420 8:56994078-56994100 ATTTAATTTAAACACCCACAAGG - Intergenic
1041993808 8:64028366-64028388 ATTACATTTGAACTATTTCATGG + Intergenic
1042391153 8:68236415-68236437 GTTTGATTTGAAAACCTTCGTGG + Exonic
1043807007 8:84684129-84684151 TTTTCATTTGAAAGCCTTCAGGG - Intronic
1047477023 8:125242442-125242464 ATTTCATTTGGACACTTTAGAGG - Intronic
1047820253 8:128511512-128511534 ATTTCATCAAAACAGCTTCAAGG - Intergenic
1048422868 8:134294511-134294533 TTTTCATTAGAACACCGCCATGG - Intergenic
1050849059 9:10261394-10261416 ATTTCAATTGAACTCCACCAGGG - Intronic
1052633847 9:31074123-31074145 ATTTTATTTTAACAGATTCAAGG - Intergenic
1053230807 9:36407448-36407470 TCTTCATTTGAACTCCTTCCTGG - Intronic
1053618795 9:39795349-39795371 AATTCATTTGAAATCCTGCATGG - Intergenic
1053895702 9:42739996-42740018 AATTCATTTGAAATCCTGCATGG + Intergenic
1054265359 9:62912080-62912102 AATTCATTTGAAATCCTGCATGG + Intergenic
1055122025 9:72671517-72671539 ATTCCATTTTACCACCTTTATGG - Intronic
1055123649 9:72692717-72692739 ATGTTATTTGAACCCCATCATGG - Intronic
1055884249 9:81040382-81040404 ATTTTAATGGAACACCTTCTAGG - Intergenic
1055960373 9:81814980-81815002 AGGTCATCTGAAAACCTTCAAGG + Intergenic
1056800026 9:89684537-89684559 ATTTCATTTTAACTCCTTGTGGG - Intergenic
1058275377 9:103035399-103035421 GTTTAATTAGAACACCTTCAAGG + Intergenic
1058535243 9:105951662-105951684 ATTTTATTTAAAAGCCTTCAGGG - Intergenic
1058960981 9:109992664-109992686 ATTACATTTGCACACTTCCAGGG - Intronic
1059052188 9:110938443-110938465 ATTGCATTTGTAAACCGTCATGG - Intronic
1186143446 X:6601428-6601450 ATTACAGGTGAACACCTCCATGG + Intergenic
1187371950 X:18716654-18716676 ATTTCAGTTTGAGACCTTCATGG + Intronic
1191648832 X:63513717-63513739 ATTTCATTTGAATGCCTTTCTGG - Intergenic
1192330957 X:70174873-70174895 ATTTCATTTGTAGACATTGAAGG - Intergenic
1194765743 X:97844273-97844295 ATCTCAGTTGAACACCGCCAAGG + Intergenic
1194824740 X:98547856-98547878 ATTTCATTTTTACAGCTTTAGGG + Intergenic
1195308197 X:103606482-103606504 ATTGCATTTGAGGTCCTTCAGGG + Intergenic
1196028330 X:111067012-111067034 ATTTCATTTAACCACCCTCCTGG + Intronic
1198323448 X:135542773-135542795 ATTAAATTTGAACACCTGAAGGG - Intronic
1198649283 X:138843412-138843434 ATTTAATTTAAACAAATTCAGGG + Intronic
1198875126 X:141216446-141216468 ATCTCATTTGAACACCTCAATGG + Intergenic
1199737231 X:150695475-150695497 ATGTAATTTGAAGACCTGCAGGG + Intronic