ID: 971779314

View in Genome Browser
Species Human (GRCh38)
Location 4:31010966-31010988
Sequence ATATTTCAACAGATTTATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971779314_971779320 15 Left 971779314 4:31010966-31010988 CCCCGATAAATCTGTTGAAATAT 0: 1
1: 0
2: 1
3: 28
4: 273
Right 971779320 4:31011004-31011026 ACAATAGCAGACTTCTTTCTTGG 0: 1
1: 0
2: 4
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971779314 Original CRISPR ATATTTCAACAGATTTATCG GGG (reversed) Intronic
900248656 1:1653668-1653690 ATCTTTTAACAGATTTATTGGGG - Intronic
902142603 1:14369401-14369423 ATTTCTCCACAGATTTCTCGTGG - Intergenic
904861749 1:33543067-33543089 AAATTTCAAAAGATTCATAGGGG - Intronic
906949785 1:50324966-50324988 ATATTGCAACAGATTGACCATGG + Intergenic
908505464 1:64793549-64793571 ATTTTTAAACAGCTTTATTGAGG + Intronic
908971666 1:69842564-69842586 ATATTCCAACAGAATTACTGGGG + Intronic
909900066 1:81122636-81122658 ATATTTAGACCAATTTATCGAGG + Intergenic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
910553220 1:88499844-88499866 GTATTTCAACATATTTCTAGAGG - Intergenic
910572417 1:88720636-88720658 TTATTTCAACAGATTTTGGGGGG + Intronic
911663213 1:100526647-100526669 AGATTTCTACAGCTTTATTGAGG - Intergenic
912185381 1:107268890-107268912 ATTTATCAACAGATATATCTAGG + Intronic
912653416 1:111462577-111462599 ATATTTGAAAATATTTATCATGG + Exonic
912991545 1:114492322-114492344 ATATTTTAACATTTTTATTGTGG + Intronic
913157544 1:116114798-116114820 AGATTTCAACAGATTGCTGGAGG + Intronic
914217810 1:145649112-145649134 ATTTTTTAACAGGTTTATTGGGG + Intronic
916537043 1:165713028-165713050 ATATTTCAAGAGTTTTATTCTGG - Intergenic
916647779 1:166803856-166803878 ATATTTAAACAGATTAAATGTGG - Intergenic
916965257 1:169933188-169933210 ATATTTCAAAAGATTTATAGTGG + Intronic
917899616 1:179529366-179529388 ATTTTTCAACAAATTTGTAGGGG - Intronic
918439206 1:184548846-184548868 ATATTTCAACAACTTTAACGTGG - Intronic
919374128 1:196770948-196770970 ATATTTCAAAACATTTATGAGGG + Intergenic
919749814 1:201030523-201030545 ACTTTTCAACAGCTTTATTGAGG - Intergenic
921430653 1:215061720-215061742 ATAATTCAACAGATTTAAAAGGG + Intronic
922028278 1:221773762-221773784 CTAATTCAGCAGATTTATTGCGG + Intergenic
922387000 1:225096329-225096351 ATATTTCAATAGCTTTATTAAGG - Intronic
922958869 1:229627472-229627494 ATGAATCAACAGATTTGTCGGGG - Intronic
924956553 1:248933799-248933821 ATATTTCGACAGATGCATTGTGG + Intergenic
1065493828 10:26308994-26309016 ATATTTGAAGAGATTTATTCTGG + Intergenic
1067384344 10:45804915-45804937 ATATTTCAGCAGCTTTACTGAGG + Intergenic
1067879849 10:50033905-50033927 ATATTTCAGCAGCTTTACTGAGG - Intergenic
1067892037 10:50145475-50145497 ATATTTCAGCAGCTTTACTGAGG + Intergenic
1067988198 10:51177140-51177162 ATAGTTCAACACATTAATCATGG - Intronic
1068667481 10:59692567-59692589 TTATTTTAACAGCTTTATTGAGG - Intronic
1069585696 10:69600004-69600026 ATATTTGAAGAGATTTATTCTGG - Intergenic
1071180488 10:82977926-82977948 AAATTTCAATAAATTTATCAAGG - Intronic
1071751859 10:88488235-88488257 ATTTTTTAACAGATTCATTGAGG - Intronic
1071959675 10:90798099-90798121 AAATTTCAACAGAGTTTTGGAGG + Intronic
1074663006 10:115684258-115684280 ATATTTCTACAAATTTATATTGG + Intronic
1075233833 10:120709094-120709116 ATAGTTCAAGAGATTTATTTGGG - Intergenic
1076962355 10:133774686-133774708 ATATTTCGACAAATGTATTGTGG + Intergenic
1077286980 11:1771585-1771607 AGTTTTCAACTCATTTATCGAGG - Intergenic
1077595874 11:3531154-3531176 ATATTTCATCACATTTAGTGTGG - Intergenic
1077737045 11:4801986-4802008 ACATTTCAACAGATTTGGAGGGG + Intronic
1078149027 11:8743199-8743221 TTTTTTAAACAGATTTATTGAGG - Intronic
1078592224 11:12652557-12652579 ATGTTTTAACAAATTTATTGAGG - Intergenic
1078988419 11:16618402-16618424 ATATTTCAATAGATATTTTGAGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080123546 11:28704752-28704774 ATATTTTAACAGAATTATTCTGG + Intergenic
1082689512 11:56282705-56282727 ATATTTGAAGAGATTTATTCAGG + Intergenic
1084251776 11:67905148-67905170 ATATTTCATCACATTTAGTGTGG - Intergenic
1084821063 11:71690880-71690902 ATATTTCATCACATTTAGTGTGG + Intergenic
1085328016 11:75623438-75623460 ATTTTTAAACAGCTTTATTGAGG - Intronic
1086111699 11:83206463-83206485 AGATTTCAACATATTTATTTTGG - Intronic
1088141646 11:106624043-106624065 ATATTTACACATATTTATTGTGG - Intergenic
1091022012 11:132108661-132108683 TTATTTCAATAGGTTTTTCGGGG - Intronic
1092422046 12:8339939-8339961 ATATTTCATCACATTTAGTGTGG - Intergenic
1092620796 12:10265397-10265419 ATATTTCAACATATATATCTGGG + Intergenic
1093374855 12:18412451-18412473 ATAAGGCAACAGATTTAACGTGG + Intronic
1094005412 12:25744083-25744105 ATATTTCAACATTCTTAACGAGG + Intergenic
1094448051 12:30554223-30554245 ATATTTGAAGACATTTATTGTGG + Intergenic
1097415946 12:59316990-59317012 ATATTTCAACAGTTTTTTATGGG + Intergenic
1098969768 12:76839526-76839548 ATTTTTAAACAAATTTATCTAGG - Intronic
1099122865 12:78713532-78713554 ATATTTTAACAGCTGTATTGAGG - Intergenic
1099624794 12:85057341-85057363 ATATCTCAACAAATTGTTCGAGG + Intronic
1104162893 12:126197744-126197766 AATTTTCAACAGATTTACTGGGG - Intergenic
1105748230 13:23397753-23397775 ATATTTGAAGAGATTTATTATGG + Intronic
1107404585 13:40100644-40100666 TTATTTCAATAGATTTTTTGGGG - Intergenic
1108502734 13:51083398-51083420 ATATTTAAAAAGATTTTTCTGGG + Intergenic
1108533631 13:51349436-51349458 ATATTTCAACAGATCTCTCAGGG + Intronic
1109018144 13:57047457-57047479 ATTTTTAAACAGCTTTATTGAGG + Intergenic
1109622709 13:64930056-64930078 ATATGTCAACAGTTTGATCTTGG - Intergenic
1110017822 13:70430616-70430638 CTATTTCAACTGATGTATCATGG + Intergenic
1110508329 13:76316213-76316235 ATATTTGAACATATTTATGGGGG - Intergenic
1111213065 13:85105858-85105880 ATAATTCAACAGAATTATCTGGG + Intergenic
1111407361 13:87826113-87826135 ATATGTCAAAAGATTTACCTTGG - Intergenic
1111600333 13:90465083-90465105 ATTTTTCAAAAGATTTATACGGG + Intergenic
1116138859 14:40962192-40962214 GTATTTTAACAGCTTTATTGAGG - Intergenic
1116782192 14:49248857-49248879 ATTTCTCAACTGATTTATTGTGG - Intergenic
1117879260 14:60294011-60294033 ACATTTCAACAGTTTTCTAGTGG - Intronic
1123690466 15:22834519-22834541 AGATTTCAACAGCTTTATTGGGG + Intergenic
1123888898 15:24755992-24756014 ATATTTGAAGAGATTTATTCTGG + Intergenic
1124067382 15:26357329-26357351 ATATTTCAATAGTTCTATCTTGG - Intergenic
1124071855 15:26402582-26402604 ATTTTTCAAGAGCTTTATGGTGG - Intergenic
1124583817 15:30987149-30987171 ACATTTCAAGAGATTTATGTCGG - Intronic
1125397569 15:39266400-39266422 ATATTTCAACAAATGTATGTGGG - Intergenic
1127137548 15:55940404-55940426 AAATTTTAACTGATTTATTGGGG - Intronic
1127433650 15:58935523-58935545 AGATTTTAAGAGATTTATCTGGG + Intronic
1127972786 15:63974782-63974804 ATATGTCAAAAGATTTATTAGGG + Intronic
1128750532 15:70145663-70145685 ATATTTCAACATATTAACAGCGG - Intergenic
1130885360 15:88088099-88088121 ATTTTTTAACAGCTTTATTGAGG - Intronic
1131605385 15:93898320-93898342 ATATTTGCACATATTTATGGGGG - Intergenic
1131718450 15:95139820-95139842 ATATTTGAACACATTTTTCTGGG + Intergenic
1133376244 16:5289635-5289657 ATATTTCATCACATTTAGTGTGG + Intergenic
1133652487 16:7825731-7825753 ATATTTTAACAACTTTATCAAGG + Intergenic
1134415090 16:14036453-14036475 ATATTTCAACATATATATGGTGG - Intergenic
1134415092 16:14036483-14036505 ATATTTCAACATATATATGATGG - Intergenic
1134415095 16:14036572-14036594 ATATTTCAACATATATATGATGG - Intergenic
1134415096 16:14036602-14036624 ATATTTCAACATATATATGATGG - Intergenic
1134415097 16:14036632-14036654 ATATTTCAACATATATATGATGG - Intergenic
1134910066 16:18017730-18017752 ATATATCATCAAATTTATCTTGG + Intergenic
1135463649 16:22666275-22666297 ATTTTTTAACAGCTTTATTGAGG + Intergenic
1135578580 16:23605752-23605774 AGGTTTCAACAGATTAATCTTGG - Intronic
1137639775 16:50018474-50018496 ATATTTCAATAGGTTTTTGGGGG - Intergenic
1137924581 16:52528093-52528115 ATATTTTAACAGAACTATCTGGG - Intronic
1138066150 16:53943303-53943325 TTATTTGAACAGTTTTATGGGGG + Intronic
1138197952 16:55067935-55067957 ATGTTTAAACAGTTTTATCGAGG - Intergenic
1139029195 16:62858957-62858979 ACAATTCAACAAATTTATTGGGG - Intergenic
1139616492 16:68097705-68097727 CTATTTCAACAGCTTTATTGAGG + Intronic
1140298327 16:73730153-73730175 ATTTTTCAACACATTGATTGTGG - Intergenic
1142949691 17:3468060-3468082 TTATTTCAACAGATTTAGCCTGG + Intronic
1143192678 17:5051783-5051805 CTATTTCAAGAGACTTATCCAGG - Intronic
1144009230 17:11130167-11130189 AAATTTTAACAGCTTTATTGAGG - Intergenic
1144420731 17:15095659-15095681 ATATTTCAGCAGATATATCATGG - Intergenic
1145291123 17:21546650-21546672 ATTTTTAAACAGCTTTATTGAGG - Intronic
1146545774 17:33736923-33736945 TTTTTTTAACAGCTTTATCGAGG + Intronic
1148255308 17:46126082-46126104 CTTTTTCAACAGCTTTATTGAGG - Intronic
1150511746 17:65759863-65759885 TACTTACAACAGATTTATCGGGG - Intronic
1151058922 17:71068151-71068173 ATATTTTAAGAGATTTAACTCGG - Intergenic
1153205142 18:2691198-2691220 ATTTTTCACCAGTTTTATCATGG - Intronic
1153374955 18:4365568-4365590 ATATTTTAATAGTTTTATTGAGG - Intronic
1155723941 18:29055227-29055249 ATCTTTTTACAGTTTTATCGAGG - Intergenic
1156434291 18:37110073-37110095 ATTTTTCAACATTTTTTTCGAGG + Intronic
1156678722 18:39563705-39563727 TTATTTCAAGAGCTTTATTGAGG - Intergenic
1157035947 18:43973948-43973970 ATATTTTAACAGCTTTACTGAGG - Intergenic
1157623643 18:49030841-49030863 ATATTGCAACAGATTGAATGTGG - Intergenic
1159084047 18:63767411-63767433 AAATATCAACAGATTGATCTGGG - Intronic
1165989561 19:39801810-39801832 TTATTTGAACAGATTTATAATGG + Intergenic
1166023700 19:40057497-40057519 ATATTTCAACATATCTCTCTTGG + Intergenic
925417831 2:3684427-3684449 AAATTTCAACAGGTTTTTGGGGG + Intronic
925957066 2:8977202-8977224 AAATTTAAACAGCTTTATTGAGG - Intronic
926576842 2:14592056-14592078 AGATTTCAACAGATTAATTTGGG - Intergenic
926788378 2:16543454-16543476 CTTTTTAAACAGATTTATTGAGG - Intergenic
928339812 2:30433156-30433178 ATATATAAACAGCTTTATTGAGG - Intergenic
929285315 2:40129147-40129169 ATCTTTTAACAGCTTTATGGTGG - Intronic
929566191 2:42986770-42986792 ATTTTTTAACAGCTTTATTGAGG + Intergenic
929674247 2:43909086-43909108 ATATTTCAAGAGATATTTTGTGG - Intronic
929774706 2:44921846-44921868 AAATTTCAACATATTAATCTGGG + Intergenic
929897067 2:45969858-45969880 ATATTACAACACATTTCTCCAGG + Intronic
930842290 2:55860978-55861000 ATAATTCAACATATTAATAGAGG + Intergenic
931466757 2:62495371-62495393 ATATTTAAACACATTTTTCTAGG + Intergenic
931489415 2:62727298-62727320 TTTTTTAAACAGATTTATTGAGG + Intronic
931492408 2:62762821-62762843 ATATTTCAACAGGCTTATATTGG - Intronic
934906802 2:98212116-98212138 ATATGTCCACAGATTTTTGGTGG - Intronic
936787673 2:116114076-116114098 ATATTTGAACACATTTATTCTGG + Intergenic
940349577 2:152667092-152667114 CTATTTCAAAAGATTTATTTAGG - Intronic
940487207 2:154311233-154311255 ATAATTGCACAGATATATCGGGG + Intronic
941557647 2:167002269-167002291 TTTTTTAAACAGATTTATCCAGG - Intronic
941961801 2:171261353-171261375 ATGTTTCTACAGCTTTATTGGGG - Intergenic
943729110 2:191283012-191283034 GTTTTTCAACAGCTTTATCTAGG - Intronic
944056828 2:195530645-195530667 ATATTTTAACAGTTTTATTTGGG + Intergenic
945831205 2:214788401-214788423 ATACTTGAACAGATTTTTCTTGG - Intronic
947022084 2:225690395-225690417 CAATTTCAAAAGATTTATTGAGG + Intergenic
1168823081 20:789963-789985 ATATTTGAAGAGATTTATTTTGG + Intergenic
1169675235 20:8145439-8145461 GTATGTCACCAGGTTTATCGTGG - Intronic
1170673448 20:18456397-18456419 ATTTTTTAACAGCTTTATTGAGG + Intronic
1173561242 20:44007094-44007116 ATTTTTTAACAGTTTTATTGAGG + Intronic
1175627041 20:60497550-60497572 ATATTTCTACATATTTCTCTTGG - Intergenic
1177066975 21:16450830-16450852 TTATTTCTACAGATTTATTTTGG + Intergenic
1177170310 21:17647877-17647899 AGAGCTCAACAGATTTATCTAGG - Intergenic
1178020712 21:28405305-28405327 ATATTTGAAAAGAATTATCAGGG - Intergenic
1184844861 22:47075533-47075555 ATATTTCTACTCATTTATAGTGG - Intronic
1184933220 22:47697422-47697444 ATATTTAAAGAGATTTATTTTGG + Intergenic
951940520 3:28073255-28073277 ATATTTCAACAGACTGAATGTGG - Intergenic
952473490 3:33681468-33681490 AGATTTCAACAGATATTTGGTGG - Intronic
952745065 3:36769178-36769200 ATATTTCTCCACATTTATCTCGG - Intergenic
953081867 3:39628513-39628535 ATATTTGTACAGATTTATGGGGG - Intergenic
954292843 3:49658752-49658774 ATGTGTAAACAGATTTACCGAGG - Intronic
955185261 3:56709166-56709188 ATATTTAAATAGATTTATTGTGG - Intergenic
956993079 3:74791452-74791474 ATATTTCAACATATGAATCTGGG + Intergenic
957065849 3:75521554-75521576 ATATTTCATCACATTTAGTGTGG - Intergenic
957376301 3:79363523-79363545 ATCTTTCAACATATTTTTCCTGG + Intronic
961899790 3:130199462-130199484 ATATTTCATCACATTTAGTGTGG - Intergenic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
963445042 3:145394912-145394934 ATATTTTAACAGCTTTATAAAGG - Intergenic
963996247 3:151712406-151712428 TTATTTCAACAGATTTGGGGGGG - Intergenic
964559215 3:157975256-157975278 ATATTTTAACAGCTCTATTGAGG - Intergenic
965204790 3:165708096-165708118 ATATATCAAAAGATTTTTCAAGG + Intergenic
965912255 3:173793303-173793325 ATATTTCACCAGATTTCCCAGGG - Intronic
966899976 3:184474580-184474602 ATATTTGAACATATTTATAATGG + Intronic
969010449 4:4057618-4057640 ATATTTCATCACATTTAGTGTGG - Intergenic
969743606 4:9052278-9052300 ATATTTCATCACATTTAGTGTGG + Intergenic
969803008 4:9584377-9584399 ATATTTCATCACATTTAGTGTGG + Intergenic
970321174 4:14877109-14877131 ATATTTCACCAGATTAATGAAGG + Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
974424789 4:61727341-61727363 ATATATAAACATATTTATAGAGG + Intronic
974719625 4:65721328-65721350 ATATTTTAACAGCTTTATTAAGG - Intergenic
975324480 4:73043974-73043996 ATATTTCCCCAGTTTTATTGTGG + Intergenic
976141529 4:81998146-81998168 TTATTTCTACAGATTTAGAGAGG - Intronic
976468323 4:85397053-85397075 ATATTTCAAAATATTTAACATGG + Intergenic
977399985 4:96520684-96520706 ATATTTTAACAGTTTTATCAAGG - Intergenic
979058416 4:116023397-116023419 TTCTTTCATCAGATTTATTGAGG - Intergenic
979560450 4:122096043-122096065 AAGTTACAAGAGATTTATCGTGG + Intergenic
980161502 4:129168940-129168962 ATATTTTAAAAGGTTTATAGCGG - Intergenic
981594762 4:146407208-146407230 ATATTTAAGCAGTTTTATTGAGG + Intronic
983254593 4:165383623-165383645 ATATTTTAACAGATTCAGAGAGG - Intronic
984314630 4:178111930-178111952 TTATTTCAATAGAGTTATCTTGG - Intergenic
984602813 4:181748211-181748233 ATATTTCCTCAAATTTATCTAGG - Intergenic
984605073 4:181775801-181775823 ATATTTGTACATATTTATGGGGG + Intergenic
985171838 4:187158276-187158298 AGATTTCAACAGATTTCTGAAGG - Intergenic
985203486 4:187507197-187507219 ATATTTCATCAAAATTATAGTGG - Intergenic
987339562 5:16927756-16927778 GTATTTCAACAGATGTGTTGTGG + Intronic
987647464 5:20693010-20693032 ATATTACAAGTGATTTATCTAGG + Intergenic
987669559 5:20989726-20989748 ATAATTCAACAGAATTATGAAGG + Intergenic
987888640 5:23845808-23845830 GTATTTCTACATATTTATGGAGG - Intergenic
988200397 5:28062109-28062131 ATTTTTCCACAGCTTTATGGAGG + Intergenic
988360936 5:30235421-30235443 ATTTTTAAACAAAATTATCGGGG - Intergenic
990292507 5:54367100-54367122 TTATTTAAACAGCTTTATTGTGG + Intergenic
994812182 5:104534115-104534137 ATATTTTAACATATTTATTGAGG + Intergenic
995095503 5:108231147-108231169 ATTTTTAAACAGCTTTATTGAGG + Intronic
996030158 5:118695817-118695839 AAATTTACACAGATTTATTGAGG - Intergenic
996248237 5:121292840-121292862 ATATCTCAACTGATATCTCGAGG - Intergenic
996708283 5:126519070-126519092 ATATTTGAAAAGATTTATTCTGG - Intergenic
996761119 5:126986891-126986913 AAATTTCAACAAATTTCTGGAGG + Intronic
996930617 5:128882271-128882293 TTATTTCAATAGATTTTTGGGGG + Intronic
1000688371 5:164282716-164282738 CTATTTTGCCAGATTTATCGAGG - Intergenic
1000811918 5:165874027-165874049 ATATTTGCACACATTTATGGGGG - Intergenic
1000823898 5:166020198-166020220 ATATTTGAAGAGATTTATTCTGG + Intergenic
1001018554 5:168163442-168163464 ATTTTTAAACAGCTTTATTGAGG + Intronic
1001520686 5:172390022-172390044 ACTTTTTAACAGATTTACCGTGG + Intronic
1002656228 5:180749988-180750010 TTATTTTAAGAGATTTATTGAGG + Intergenic
1007827691 6:44613406-44613428 ATGTTTCAACTGATTAATGGTGG - Intergenic
1009448719 6:63775820-63775842 ATTTTTGAACAGCTTTATTGAGG + Intronic
1010213313 6:73379900-73379922 ATATTGCAACAGATTTAATTTGG - Intronic
1013160663 6:107541323-107541345 ACATTTCAACATATTTATGAAGG - Intronic
1014417423 6:121199150-121199172 GTATTTCTACAGATTTGTTGTGG + Intronic
1014648032 6:123999633-123999655 ATATTTCAACAACTTTAAGGTGG - Intronic
1015734468 6:136383738-136383760 ATATTTCGAAAGATTCATGGTGG + Exonic
1016216483 6:141609574-141609596 ATATTTCAAAAGTTTTATTGAGG - Intergenic
1019030346 6:169004708-169004730 ATATTTGAAGAGATTTATTCTGG - Intergenic
1020192349 7:6009648-6009670 ATGTTTTAAAAGATTTATCCAGG + Intronic
1020524123 7:9236703-9236725 ATATTTCAAAATATTTGTCTAGG - Intergenic
1021685756 7:23183601-23183623 ATATTTCACTAGATTAATTGTGG - Intronic
1022811997 7:33878838-33878860 ATCTTTAAACAGCTTTATTGAGG - Intergenic
1022904835 7:34845585-34845607 ATATTTAAAAAGACTTATCAAGG - Intronic
1022909744 7:34889180-34889202 ATATTTCAAGAGATTTAAAGAGG + Intergenic
1023299009 7:38748574-38748596 ATAGTTCAGCAGATTTATACCGG - Intronic
1023369069 7:39494805-39494827 GTATTTCAACAGCTTTATGCAGG - Intergenic
1023411694 7:39894494-39894516 ATATTTGAAGAGATTTATTCTGG - Intergenic
1026648505 7:72194087-72194109 TTATTTCAATAGATTTTTTGGGG - Intronic
1028254612 7:88578495-88578517 AATTTTTAACAGATTTATTGAGG + Intergenic
1029069736 7:97885619-97885641 ATATTTCATCACATTTAGTGTGG - Intergenic
1031443315 7:121820758-121820780 ATATTTTAACAGCTTTATTGAGG - Intergenic
1031530546 7:122870820-122870842 ATATTTGAACAGATTTCATGTGG - Intronic
1032160530 7:129506093-129506115 ATTTCTTAACAGATTTATTGAGG + Intronic
1032713504 7:134483900-134483922 ATATTTACACATATTTATTGAGG - Intergenic
1032817342 7:135490194-135490216 ATGTTTCAACAGAATGATAGTGG - Intronic
1032994816 7:137433146-137433168 ATATTTTAACAGCTTTATCCAGG + Intronic
1034390485 7:150783485-150783507 ATTTTTCAAAAGATTTCTAGTGG - Intergenic
1035894513 8:3383283-3383305 ACATTTTAACAGCTTTATTGAGG - Intronic
1036251983 8:7170287-7170309 ATATTTCATCATATTTAGTGTGG - Intergenic
1036365507 8:8117174-8117196 ATATTTCATCATATTTAGTGTGG + Intergenic
1036532399 8:9604968-9604990 ATATTTTAAAAGCTTTATAGAGG - Intronic
1036885437 8:12548933-12548955 ATATTTCATCACATTTAGTGTGG - Intergenic
1036935629 8:12999513-12999535 ATATTTTAACAGTTTTATTTAGG - Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1039749078 8:40459981-40460003 ACATTTCATCATATTTATCTTGG - Intergenic
1040735210 8:50498296-50498318 ACATTTCAGAAGATTTATAGTGG + Intronic
1041249440 8:55920128-55920150 ATAATTCAGCAGATTAATTGTGG + Intronic
1043316902 8:78934012-78934034 AAATTTTAACAGCTTTATTGAGG + Intergenic
1043718436 8:83512722-83512744 ATATTTAAAGAGATTTATTCTGG + Intergenic
1044282015 8:90367361-90367383 ATACTTCAACATATTTATTTTGG + Intergenic
1045610350 8:103833708-103833730 ATATCTCAACAGAGATATAGTGG - Intronic
1045987816 8:108269676-108269698 ATTTTTAAACAGCTTTATTGAGG + Intronic
1046794775 8:118359097-118359119 ATATTTTAACATATTAATTGGGG - Intronic
1047268790 8:123334678-123334700 ATTTTGCAAGAGATTTATAGAGG + Intronic
1049870279 8:144969671-144969693 ATATTTGAAGAGATTTATTCTGG - Intergenic
1050947617 9:11546118-11546140 ATATTTCAAAAGATTCACCCTGG - Intergenic
1052557903 9:30042825-30042847 ATATTTCTACAGAAATATCATGG - Intergenic
1055584280 9:77741407-77741429 ATATAATGACAGATTTATCGGGG - Intronic
1055684624 9:78758079-78758101 ATATTTTAACAGATTGATGTGGG + Intergenic
1057021421 9:91700607-91700629 ATTTTTCACCAGCTTTATTGAGG + Intronic
1057023254 9:91717386-91717408 ATATTTTAACAGCTTTGTTGTGG - Intronic
1058281485 9:103121670-103121692 ATATTTTAACAGCTTTATTGAGG - Intergenic
1059541380 9:115133606-115133628 ATATTTCAACATAATTTTAGGGG + Intergenic
1060364580 9:122997672-122997694 AAATTTCAAAGGATTTATAGGGG + Intronic
1187659442 X:21524202-21524224 ATATTTCAACTGGTTTATCATGG - Intronic
1187778087 X:22786449-22786471 ATTTTTTAACAGCTTTATGGAGG + Intergenic
1189585560 X:42458242-42458264 TTATTTCAATAGTTTTATTGGGG + Intergenic
1189646582 X:43139305-43139327 ATATTTCACCAGATATGTCTAGG + Intergenic
1190791145 X:53701525-53701547 AAATTTGAACAGATTTATGAAGG + Intergenic
1190791697 X:53706621-53706643 AAATTTGAACAGATTTATGAAGG + Intergenic
1192379298 X:70599059-70599081 ATATTTTAACAGACTTATTGAGG - Intronic
1194079016 X:89434660-89434682 TTATTTGAACATATTTATCATGG + Intergenic
1194210866 X:91066844-91066866 ATATTTCAGCATATTCATAGTGG - Intergenic
1194634146 X:96323141-96323163 ATATTTCTACAGATGTAAAGAGG - Intergenic
1195361788 X:104089314-104089336 CAATTTCAACAGATTTGTGGAGG - Intergenic
1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG + Intergenic
1195788362 X:108553547-108553569 ATATTCTAACAGGTTTATGGTGG - Intronic
1196365193 X:114915858-114915880 ATTTTTTAACAGTTTTATTGTGG + Intergenic
1196482945 X:116171935-116171957 ATATTTCAAAAGATTAGTCAGGG - Intronic
1198748515 X:139915301-139915323 GTTTTTAAACAGCTTTATCGAGG - Intronic
1199765202 X:150936272-150936294 TTTTTTTAACAGATTTATTGAGG + Intergenic
1200431638 Y:3089978-3090000 TTATTTGAACATATTTATCATGG + Intergenic
1200826210 Y:7645352-7645374 ATATTTCCACAGCTTTATTTTGG + Intergenic
1201060763 Y:10043983-10044005 ATATTTCAGCAGCTTTATTTTGG + Intergenic
1202106615 Y:21375889-21375911 ATATTTCCACAGCTTTATTTTGG + Intergenic
1202110673 Y:21415155-21415177 AGATTTCAACAGCTTTATTTTGG + Intergenic
1202198474 Y:22321964-22321986 ATACCTCAACAGATTGATGGAGG - Intronic
1202201011 Y:22348074-22348096 ATATTTCCACAGCTTTATTTTGG - Intronic
1202233750 Y:22684819-22684841 ATATTTCAACAGCTTTATTTTGG - Intergenic
1202309406 Y:23511339-23511361 ATATTTCAACAGCTTTATTTTGG + Intergenic
1202561395 Y:26159253-26159275 ATATTTCAACAGCTTTATTTTGG - Intergenic