ID: 971786290

View in Genome Browser
Species Human (GRCh38)
Location 4:31107237-31107259
Sequence GGTGAAATAATGCAAATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971786290 Original CRISPR GGTGAAATAATGCAAATTGA AGG Intronic
901216338 1:7557583-7557605 GGTGAAGTAATACACATTCATGG + Intronic
902260116 1:15218833-15218855 GGTGGGTTAATGCAAATTGAGGG - Intronic
904253460 1:29240137-29240159 GGTGAACTCCTGCAACTTGATGG + Intronic
904462998 1:30691493-30691515 GGTGAAGGAATGTGAATTGAAGG - Intergenic
904888953 1:33763652-33763674 GGTGAAATCAGGCAGACTGAAGG - Intronic
905611814 1:39359201-39359223 CGTGACATAATGGAAATTGAAGG + Exonic
905764938 1:40592498-40592520 GGTGGGTTAATGCAAATTGAGGG - Intergenic
907695788 1:56727314-56727336 GGGGAAAAAATGCAAATTATAGG - Intronic
909150051 1:71990619-71990641 GGTAAAATGATGATAATTGAGGG + Intronic
909534805 1:76724753-76724775 GGTGAACCCATGCAAATTCATGG - Intergenic
910616859 1:89207716-89207738 GGTGAACTAATATAGATTGAAGG + Intergenic
910899360 1:92103108-92103130 TGTGAGTTATTGCAAATTGATGG + Intronic
910899364 1:92103164-92103186 TGTGAGTTATTGCAAATTGATGG + Intronic
911331992 1:96535398-96535420 TGAGCAGTAATGCAAATTGATGG - Intergenic
915013280 1:152709521-152709543 GCTAAAATAATGCAAATCCAAGG - Intergenic
916248284 1:162709923-162709945 GGAGAGAAAATGCAAACTGAAGG - Intronic
916999866 1:170345873-170345895 GGTGAAATAATGCCAAAGTAAGG + Intergenic
917128232 1:171711739-171711761 GGAGAAATAAAGCAAATCCATGG + Intronic
917706776 1:177642664-177642686 GTTCAAATAAAGAAAATTGAAGG + Intergenic
918740181 1:188120563-188120585 GGTGAAATGAAGCAGATTGGAGG + Intergenic
919048959 1:192488721-192488743 GGAGATATGATGCAACTTGAGGG - Intergenic
920119224 1:203643204-203643226 GGTGAAATAAGGCAGAGTGGAGG + Intronic
920389571 1:205590889-205590911 GGTGAAATAATACAGATGAAGGG - Intronic
921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG + Intergenic
923202459 1:231725491-231725513 GGTGAGCTAGTGCAAATTGAGGG - Intronic
924273049 1:242354305-242354327 GGTGGATCAATGCAAATTCAGGG - Intronic
1064461714 10:15541013-15541035 GGTGGGTGAATGCAAATTGAAGG - Intronic
1065386605 10:25140036-25140058 TGTGAATTACTGCAAACTGAGGG + Intergenic
1066273135 10:33843178-33843200 GGAGAAATAACACAAATTAAAGG - Intergenic
1066711663 10:38242354-38242376 GGTGGATCAATGCAAATTCAGGG + Intergenic
1067492144 10:46719472-46719494 GGTGAAATTATGCTAAATAAGGG - Intergenic
1067960109 10:50838698-50838720 GGTGGATAAAAGCAAATTGAAGG + Intronic
1068267805 10:54676853-54676875 GGTGAAATAAATCAAAATCAAGG + Intronic
1070384495 10:75912380-75912402 GGTGACAGAATCCAAATAGAAGG + Intronic
1071653873 10:87426325-87426347 GGTGAAATTATGCTAAATAAGGG + Intergenic
1073369997 10:102979512-102979534 GGAAAAATAATGCAAAATAAAGG - Intronic
1074834373 10:117274997-117275019 GGTTAAAAAATGAAATTTGAGGG - Intronic
1075152009 10:119942078-119942100 GATGAAATAAAGAAAAATGAGGG + Exonic
1075507032 10:123032887-123032909 GGGGAAAGAATGGAAATTGGAGG - Intronic
1075787822 10:125061861-125061883 AGTGAATTCATGCAAAGTGACGG - Intronic
1076330323 10:129659586-129659608 GATGAGTTAGTGCAAATTGAGGG + Intronic
1078234126 11:9468482-9468504 GGTGAAATGTTGAAACTTGAAGG - Intronic
1078978998 11:16510367-16510389 GCTGAATTAATACAAGTTGAAGG - Intronic
1079281867 11:19094870-19094892 GGTGAGATAATAAAAATTCAAGG - Intergenic
1081464615 11:43304968-43304990 AGTGTAATAATGAAAAATGAGGG + Intergenic
1082299063 11:50483110-50483132 GGTGAAAAAATGCAAATCCCAGG - Intergenic
1082299110 11:50483970-50483992 GGTGAAAAACTGCAAATCCAAGG - Intergenic
1082588803 11:54978959-54978981 GGTGAAAAAATGAATATTGTAGG + Intergenic
1083909886 11:65700480-65700502 GGTGAGTTAATGCAAATTGATGG + Intergenic
1086319251 11:85628041-85628063 GGCTAAAGGATGCAAATTGAGGG + Intergenic
1087006630 11:93478094-93478116 GCTGAAAGGATGCAAATTGTTGG - Intergenic
1087984116 11:104656475-104656497 GATGGAATAATACAAATTGAGGG + Intergenic
1090681911 11:129068849-129068871 GATGAGATACTGCAAATTGAGGG - Intronic
1094697792 12:32838622-32838644 AGTGAACAAATGAAAATTGATGG - Intronic
1095150937 12:38796350-38796372 TATAAAATAATGCAAATTTAGGG + Intronic
1095724192 12:45434098-45434120 GGTGAAATTATGAGAAATGAAGG - Intronic
1095840602 12:46687606-46687628 GGTAAAATAGTGCTCATTGAAGG + Intergenic
1099839133 12:87943973-87943995 GGCAAGCTAATGCAAATTGATGG + Intergenic
1099966328 12:89449918-89449940 AGTGAAACAATACAAATTGAGGG + Intronic
1100020192 12:90059988-90060010 GGTCAAATAATGTTATTTGATGG - Intergenic
1100426444 12:94491464-94491486 TGTGAAAGAATGCAATTGGAAGG + Intergenic
1101262047 12:103043501-103043523 GGTGAAATAATCCAAATACGGGG - Intergenic
1102827229 12:115959087-115959109 AGTAAAATAATGCATATTTAAGG + Exonic
1104412400 12:128570161-128570183 GGTGAAAGAAAGAAAATTCAAGG + Intronic
1105796263 13:23856510-23856532 GGTGGGTTAATGCAAATTGGGGG + Intronic
1107519052 13:41161053-41161075 GGATAAATAAAACAAATTGATGG + Intergenic
1108048450 13:46405722-46405744 GGTGGGCTAATGCAAATTTAGGG - Intronic
1108092229 13:46860770-46860792 ACTGAAATAATGAAATTTGATGG + Intronic
1108376819 13:49821748-49821770 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1109056869 13:57561980-57562002 ACTGAAAAAATGCTAATTGATGG - Intergenic
1110497054 13:76180349-76180371 GGCAGATTAATGCAAATTGAGGG - Intergenic
1111179600 13:84645782-84645804 GGTGGATCAATGCAAATTGAGGG + Intergenic
1111487430 13:88922292-88922314 GGTTAAATAATGCTAAATGTGGG - Intergenic
1111681921 13:91452651-91452673 GGAGAAATAGGGGAAATTGATGG + Intronic
1111968269 13:94883071-94883093 GGTGACATTATGAAAATAGAAGG - Intergenic
1112392207 13:98995838-98995860 GCTGAGTTAGTGCAAATTGAGGG + Intronic
1112610735 13:100952375-100952397 GGTGAAATAGTGGGAATAGATGG + Intergenic
1112751486 13:102588330-102588352 GGTGGGTTAATGCAAACTGAGGG + Intergenic
1112850476 13:103700110-103700132 GGTAAAATAAAGGATATTGAAGG + Intergenic
1113032418 13:106008949-106008971 GGGAAAATAATACAAAATGAAGG - Intergenic
1113225711 13:108157899-108157921 AGTTAAATAATGCAAACTCATGG + Intergenic
1116138461 14:40958017-40958039 AGTGAAATGAAGCAAATGGATGG - Intergenic
1116764979 14:49059430-49059452 GGTGAAATTCTGCCAATTCAGGG + Intergenic
1117095986 14:52298592-52298614 GGTGAAAAAATGCCATTTCATGG - Intergenic
1118535025 14:66753039-66753061 GTTTAAATAATGAAAATTTATGG + Intronic
1118933235 14:70262533-70262555 AGTGAAGAAATGCATATTGAAGG + Intergenic
1119803347 14:77464828-77464850 GGTGAATGAATGCATATTGCAGG - Intronic
1119925800 14:78492342-78492364 TATGAAATAATGTTAATTGACGG - Intronic
1124073383 15:26416906-26416928 CATGAAATAATGCTATTTGAAGG + Intergenic
1125229336 15:37433237-37433259 AGGGAAAAAATGCAAATTGCTGG + Intergenic
1126228885 15:46302388-46302410 GGTGACAAACTGCAAATCGAAGG + Intergenic
1127252995 15:57261413-57261435 GGTAAAATCATGCAAAGTCATGG + Intronic
1127796584 15:62443641-62443663 GGTGAAATCAGGGAAAATGAGGG - Intronic
1128320444 15:66690048-66690070 GGTGAGATAATTCCAAATGAGGG - Intergenic
1128948265 15:71846866-71846888 AGTGAACTAATCCAAATTGGTGG - Intronic
1129943939 15:79523135-79523157 AGTGGAATCATGCAAATGGAGGG - Intergenic
1130018870 15:80210367-80210389 GTTTAAATAAAGCAGATTGAAGG - Intergenic
1130087825 15:80793164-80793186 GGTGCAATAGTGAAATTTGAAGG + Intronic
1131758995 15:95599302-95599324 AGTGAAATAATTAAAATTAAAGG - Intergenic
1131817997 15:96242744-96242766 AGTGAAATACTGTAAATTAAGGG - Intergenic
1131954016 15:97711872-97711894 GTTGAAATAAATCAAAATGAAGG + Intergenic
1133628491 16:7594363-7594385 GGTGAAATCATGCAATATGTTGG - Intronic
1134589440 16:15440461-15440483 GCTGAAATAATGCAAATTGCTGG + Intronic
1135831146 16:25774657-25774679 GATGAAATAATGCAATGTGTAGG + Intronic
1140614157 16:76639977-76639999 GGTGAGTCAATGCAAATTGATGG + Intergenic
1140742208 16:77951640-77951662 GGTGAAATTAAGGAAATTTAAGG + Intronic
1144303057 17:13941311-13941333 GGTGAGTCAATGCAAATTGAGGG + Intergenic
1149555327 17:57569467-57569489 GGTGAACTCCTGCAAATGGAGGG - Intronic
1151301338 17:73229501-73229523 AATGAAATAATGCAACGTGATGG - Intronic
1156177291 18:34561615-34561637 AGTGAAATAATGCTATTTAATGG + Intronic
1157930954 18:51822786-51822808 GGAGAAAGAAAGCAAATTAATGG - Intergenic
1158533428 18:58284123-58284145 GCTTAAACAATGGAAATTGATGG - Intronic
1159096142 18:63904376-63904398 TGAGAAATAAGGCAAATTGTAGG + Intronic
1159337061 18:67081955-67081977 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1159337071 18:67082028-67082050 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1159677555 18:71304727-71304749 AGTGTAATAAGGCAAATTTAAGG - Intergenic
1160066736 18:75582568-75582590 GGTTAAAAAATGTAAATTGCTGG + Intergenic
1162190758 19:8944675-8944697 AGTGAATTAATGAAAATAGAGGG - Intronic
1164717288 19:30402583-30402605 GGTGAAAAAAGGCAAATGGAAGG - Intronic
1165753920 19:38280626-38280648 GGAGAAAAAATGCCTATTGAGGG - Intronic
925492878 2:4414536-4414558 GGTAAGAGAATGCAAATTGTTGG + Intergenic
927520930 2:23697550-23697572 GGGGGAAAAATACAAATTGAGGG - Intronic
928715777 2:34058571-34058593 TGAAAAATAATGCAAAATGAGGG + Intergenic
928913998 2:36452189-36452211 GGAGAAATTATTCAAATTAAAGG - Intronic
929126082 2:38523880-38523902 AGTGGAAGAATGCAAAGTGAAGG + Intergenic
929180909 2:39038064-39038086 TGTGAAATAATAAAACTTGAAGG - Intronic
929419850 2:41779383-41779405 GGTGAATTCATGCAAATGTATGG + Intergenic
929520065 2:42641482-42641504 CGTGAAATAATGCTAATTTCTGG - Intronic
930213588 2:48669773-48669795 GGTGAAATAATTCAAGTAGATGG + Exonic
930863708 2:56102496-56102518 GGTGGGCCAATGCAAATTGAGGG - Intergenic
930887171 2:56339237-56339259 GGTGAAATAATGAAAAAAAATGG - Intronic
931969894 2:67574467-67574489 GGAGAAATAATGGAAATTTCTGG + Intergenic
933243208 2:79945969-79945991 GGTGAAATAATTCAAGGAGAAGG + Intronic
933486887 2:82935444-82935466 GGTGGGTCAATGCAAATTGAGGG - Intergenic
934084124 2:88495525-88495547 AGTTATAAAATGCAAATTGAAGG + Intergenic
934468269 2:94286728-94286750 GTTGATATGATGCAGATTGAAGG + Intergenic
934593119 2:95576120-95576142 GGAGCAACAATGCAAATTTAGGG + Intergenic
935716754 2:105946021-105946043 GGTGAAATAATCTTAATTTAAGG + Intergenic
936904555 2:117522132-117522154 TGTGAAATATTGAATATTGAAGG + Intergenic
937695792 2:124807191-124807213 GGAGAAATAATGATAATTCAAGG - Intronic
938644825 2:133319941-133319963 ACTGAAAGACTGCAAATTGAGGG + Intronic
940540159 2:155004448-155004470 TGTGAGAAAAAGCAAATTGAGGG + Intergenic
940762938 2:157757838-157757860 GGAGAAAAAATTCAAATTTAAGG + Intronic
942240271 2:173956948-173956970 GGTGTATTAATACAATTTGAGGG + Intronic
943721283 2:191205897-191205919 TGTGAAATGATGCACAGTGAGGG - Intergenic
946613807 2:221487592-221487614 GGTGAAAAAATTAAAATTAAAGG - Intronic
1168865596 20:1083243-1083265 GGTGAAATATGGCAAATTCATGG + Intergenic
1169636684 20:7699902-7699924 GGGCAAATATTCCAAATTGATGG + Intergenic
1169966299 20:11221460-11221482 GGGGAAACAATGAATATTGAAGG + Intergenic
1171344438 20:24455170-24455192 TGTGAAGGAATGCAAAATGAGGG - Intergenic
1172892940 20:38279821-38279843 GGGGAAATAATGCAGAGTAAGGG + Intronic
1173891977 20:46519781-46519803 AGTGGATCAATGCAAATTGAGGG - Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1174993699 20:55542462-55542484 GTTGAAATCATGTAATTTGAAGG + Intergenic
1175215058 20:57387960-57387982 GGTGAGAAAATGGAAATTGCAGG - Intergenic
1177355760 21:20004701-20004723 GATGAGTCAATGCAAATTGAGGG - Intergenic
1178026795 21:28477634-28477656 GGTGAGGTAATGCAAATTGAGGG - Intergenic
1178042339 21:28653002-28653024 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1179993805 21:44964332-44964354 GGGGAAAAAAAGCAAATTGAGGG - Intronic
1183886435 22:40887038-40887060 GGAGAAATAATTAAGATTGATGG - Intronic
949130742 3:497572-497594 TGTTAAAAAATGCAAATTGTGGG + Intergenic
951641654 3:24843412-24843434 GGTGAGAAAATGTAAATTCAGGG - Intergenic
958777397 3:98502641-98502663 GGTCAAGTAATGCAATATGAGGG + Intronic
959810908 3:110618050-110618072 GGTGAAATACTTTAAATAGAAGG + Intergenic
960060458 3:113314803-113314825 GGTAAAATGATGTAAAATGATGG + Intronic
960283704 3:115803686-115803708 TATGAAATAAAGCAAATAGATGG - Exonic
960918012 3:122716858-122716880 GGTGAAATATGGAAAATTGAGGG - Intronic
962432627 3:135334200-135334222 GGGGAAATAAAGTAAATTGGAGG - Intergenic
964436964 3:156663648-156663670 GGACAAAGAAAGCAAATTGAAGG - Intergenic
965357472 3:167694131-167694153 GGTGAAATAATTTAATTTGCTGG - Intronic
965752738 3:171993204-171993226 GGTGAAAGAATGATATTTGAAGG - Intergenic
966513547 3:180791551-180791573 GGTGAACTATTGCAGATTCAAGG + Intronic
966526584 3:180925691-180925713 TGTTAAATCATTCAAATTGATGG + Intronic
967397968 3:189027943-189027965 GATGAAATAATGAATAATGAGGG - Intronic
970894101 4:21082507-21082529 GCTGTAATAAAGCAAATTGTTGG - Intronic
971555586 4:28010815-28010837 GGAGAAAGAATGCAAACAGAAGG + Intergenic
971786290 4:31107237-31107259 GGTGAAATAATGCAAATTGAAGG + Intronic
972181855 4:36476573-36476595 GGTAAAACAATGCGAATTGTTGG - Intergenic
972608066 4:40631940-40631962 GATGAAATAAAGAAAAATGAGGG - Intergenic
972858968 4:43143541-43143563 AGTGGAATCAAGCAAATTGAAGG - Intergenic
973295624 4:48517304-48517326 TGTGAACTAATGAAAAGTGAGGG - Intronic
974002428 4:56525184-56525206 GGTGAAATAATACAAATATGGGG + Intergenic
974002482 4:56525530-56525552 GGTGAAATAATACAAATATGGGG + Intergenic
974262912 4:59547544-59547566 AGTGAGAAAATGAAAATTGAAGG - Intergenic
974433755 4:61831528-61831550 TGTGAAAGAATGCAATTTCAAGG + Intronic
974749670 4:66120482-66120504 GTGGAAATATTTCAAATTGAAGG + Intergenic
977392446 4:96428826-96428848 AGAGAAATAGGGCAAATTGAAGG - Intergenic
978545549 4:109868805-109868827 GTTGAAATAATGAAACCTGATGG + Intronic
979803750 4:124944789-124944811 AGTGAAATAATTTAAAATGAAGG - Intergenic
979988513 4:127344931-127344953 TGTGAAATAAAGAAAAATGATGG + Intergenic
981184705 4:141787428-141787450 GGGGAAATAAGGGAAATTAAGGG - Intergenic
981834309 4:149037688-149037710 AGTGAAATAATAAAAATTAAAGG + Intergenic
983054674 4:163087442-163087464 GGTGACAGAGTGCAAATGGAGGG + Intergenic
984276512 4:177617693-177617715 GGTAAACTATTCCAAATTGATGG - Intergenic
985009204 4:185565330-185565352 TGTAAATTCATGCAAATTGATGG + Intergenic
985997913 5:3606854-3606876 GGTGAAATCTTCCAAATTGAAGG + Intergenic
986045457 5:4032632-4032654 GGTGAAATAATTCAATTTGCAGG + Intergenic
986922729 5:12707427-12707449 TGTGAAATAATGGAAGGTGAAGG - Intergenic
987145749 5:14989792-14989814 GGGAAATTAATGGAAATTGAAGG + Intergenic
988397648 5:30715221-30715243 GGTGAAATTATGGAAAATAATGG - Intergenic
988565881 5:32320002-32320024 GGAGAAATGATGGAAAATGACGG - Intergenic
990268998 5:54114521-54114543 ACTGGAATAATGAAAATTGAGGG + Intronic
990726780 5:58764795-58764817 CGTGAAAGTATACAAATTGATGG - Intronic
993073530 5:83197321-83197343 TGTGAAATAAATCAAATTAAAGG + Intronic
993268752 5:85764986-85765008 GGAGACAGAATGCAAAATGACGG - Intergenic
993346990 5:86796481-86796503 TCTGAAATAACGGAAATTGAAGG - Intergenic
993348882 5:86821783-86821805 GGGGAAAAAAAGCAAATTAAAGG + Intergenic
993564620 5:89457925-89457947 GGTGTGATGATGCAAATAGAAGG + Intergenic
993595173 5:89845350-89845372 GGTGGAATAATGGAAATTTCTGG + Intergenic
993693519 5:91032468-91032490 GGTGAAATAAAGACAAATGAAGG - Intronic
993747357 5:91617449-91617471 GGTGAGATAAAGATAATTGAAGG - Intergenic
995658369 5:114452563-114452585 CCTGAAATAAAGCTAATTGATGG + Intronic
995766007 5:115619932-115619954 GGTGAAATATTGAAGATTAATGG - Intronic
996602997 5:125288667-125288689 GTGGAATTAATGCAAATAGAGGG - Intergenic
997065445 5:130554185-130554207 GGTGGGTCAATGCAAATTGAGGG - Intergenic
997078153 5:130705493-130705515 GGTGAAATAACACGAATTGCAGG - Intergenic
997418835 5:133750308-133750330 GGTGAATTAAAGCAAAATGTTGG + Intergenic
997988428 5:138523757-138523779 AGTGAAATAATGCACTTTAAAGG + Intronic
998992781 5:147837072-147837094 GGAAAAATTATGAAAATTGAGGG - Intergenic
999896854 5:156043635-156043657 GCTGAAATAATGAGAACTGAAGG - Intronic
1000512436 5:162200040-162200062 TGTTAAAGAATGCAAATTAATGG - Intergenic
1003043807 6:2714335-2714357 GGTGAGTTAATGCAAATTGAGGG - Intronic
1004721571 6:18272328-18272350 GGTCAAATAAGGCAATGTGATGG + Intergenic
1004856323 6:19754356-19754378 GGAAAAATAATGCAAATTAGTGG + Intergenic
1005637150 6:27763281-27763303 GTTGAAATAATATGAATTGATGG - Intergenic
1007990077 6:46245915-46245937 GAGGAAATAATAGAAATTGAAGG - Intronic
1008381698 6:50844908-50844930 GGCAAAATAATGCAAAGTGAAGG + Exonic
1009370477 6:62894377-62894399 TGTGGATTAATGCAAATTGAGGG + Intergenic
1010675912 6:78742751-78742773 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1010726370 6:79338532-79338554 GATGCAATAAGGAAAATTGAAGG + Intergenic
1011860906 6:91754807-91754829 GGAATAATAATGCAGATTGATGG + Intergenic
1012385081 6:98671530-98671552 GGTGGAATACTCCAAGTTGAAGG - Intergenic
1012415030 6:99004047-99004069 GAGGAAATCAGGCAAATTGAGGG - Intergenic
1012944647 6:105452244-105452266 GGTGAAAGAGTGCAAATAGAGGG - Intergenic
1013309216 6:108878274-108878296 GATGAAAAAATGTTAATTGAGGG - Intronic
1013323679 6:109022255-109022277 GGTAAATGAATGCCAATTGATGG + Intronic
1014946375 6:127503530-127503552 GGTGAAAAAATGTAAAATGAGGG - Intronic
1016370254 6:143366290-143366312 GGAGAAAGAATGCAAGTTGTGGG - Intergenic
1020708563 7:11576362-11576384 GGGAAAATAACTCAAATTGATGG - Intronic
1023892034 7:44399772-44399794 TGAGAAATAATCTAAATTGAGGG + Intronic
1024747670 7:52427160-52427182 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1028016858 7:85726306-85726328 GGAGATATAATGCAAATACAAGG - Intergenic
1029012467 7:97276416-97276438 CGTGAAATTATGGAACTTGAGGG + Intergenic
1030343963 7:108412145-108412167 ATTGGAATAATGAAAATTGATGG - Intronic
1032815457 7:135469506-135469528 GGTGTAAAAATGTAATTTGATGG + Intronic
1033043549 7:137940056-137940078 GGTTGAAAACTGCAAATTGAAGG - Intronic
1034326873 7:150244553-150244575 GGAGAAATAATGAAAATAAAAGG + Intronic
1034766333 7:153724898-153724920 GGAGAAATAATGAAAATAAAAGG - Intergenic
1037696413 8:21227998-21228020 GGTGAAATAATAAAAATACAGGG - Intergenic
1040321327 8:46307430-46307452 GGTGAAAAAATGAAAATTTGGGG - Intergenic
1042659770 8:71141555-71141577 TGTCAAAAAATGAAAATTGAAGG - Intergenic
1043988899 8:86728261-86728283 GGTGAAATATTGAAAGTTGTAGG + Intronic
1045838848 8:106556106-106556128 GGAGACAGAATGCATATTGATGG + Intronic
1046268383 8:111860396-111860418 GGTTAAAAAATACAAATTAATGG + Intergenic
1046310401 8:112428782-112428804 GGTGGAATAATGAGAATTCAGGG - Intronic
1047540623 8:125762161-125762183 GATGAATGAATGCAAAATGATGG - Intergenic
1050024435 9:1319539-1319561 GGTGAAAGAATGTAAACTTATGG + Intergenic
1050823765 9:9916914-9916936 TTTGAAATAATACAAATTAATGG + Intronic
1052576831 9:30301646-30301668 GGGGAAAGAATGCAAAAAGAGGG + Intergenic
1053698676 9:40664752-40664774 CTTGATATGATGCAAATTGAAGG + Intergenic
1054309965 9:63464153-63464175 CTTGATATGATGCAAATTGAAGG + Intergenic
1054408753 9:64788305-64788327 CTTGATATGATGCAAATTGAAGG + Intergenic
1054441912 9:65272119-65272141 CTTGATATGATGCAAATTGAAGG + Intergenic
1054488371 9:65749378-65749400 CTTGATATGATGCAAATTGAAGG - Intergenic
1056261980 9:84858077-84858099 GGTGACTGATTGCAAATTGAGGG - Intronic
1056618664 9:88191446-88191468 GGTGAATTAATGCAAATTAAGGG + Intergenic
1059818262 9:117942765-117942787 GGGAAAATAATTTAAATTGATGG + Intergenic
1060011019 9:120042871-120042893 AGGGAAATGAGGCAAATTGATGG + Intergenic
1202781043 9_KI270717v1_random:37959-37981 CTTGATATGATGCAAATTGAAGG + Intergenic
1187283642 X:17882355-17882377 GAGGAAATAATACAAATAGATGG + Intergenic
1187809824 X:23163326-23163348 GGTGAAACAATGGAGATAGATGG + Intergenic
1188387526 X:29579278-29579300 GTTGAAATAAAGCAAATGGGAGG + Intronic
1189417102 X:40824989-40825011 GGTGAAATAATTAAATGTGAGGG + Intergenic
1190364637 X:49680109-49680131 GGTCAGTCAATGCAAATTGAGGG + Intergenic
1190682074 X:52834999-52835021 GGTAGGTTAATGCAAATTGAAGG + Intergenic
1190998999 X:55639145-55639167 GGTGGGTTAATGCAAATTGAAGG + Intergenic
1192034599 X:67548152-67548174 AGTGAAAGAAGGCAAATTGCTGG - Intronic
1193294672 X:79820520-79820542 AATGAAATAATGCAAATTTGGGG - Intergenic
1194358855 X:92921965-92921987 AGTTAAATGATGCAATTTGAGGG + Intergenic
1195268835 X:103211340-103211362 AGTGGGTTAATGCAAATTGAAGG - Intergenic
1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG + Intergenic
1195539575 X:106047267-106047289 ACTGAAAAAATGCAAATTGTGGG + Intergenic
1198846586 X:140918743-140918765 GGTGGGTTAATGCAAAATGAAGG - Intergenic
1200403823 Y:2788440-2788462 GGTGAAATATGATAAATTGATGG - Intergenic
1200667070 Y:6037978-6038000 AGTTAAATGATGCAATTTGAGGG + Intergenic