ID: 971797469

View in Genome Browser
Species Human (GRCh38)
Location 4:31246553-31246575
Sequence ACACATAGACTGAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971797466_971797469 23 Left 971797466 4:31246507-31246529 CCTAACTATATTCTTTCTATAAG No data
Right 971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971797469 Original CRISPR ACACATAGACTGAAGGTAAA GGG Intergenic
No off target data available for this crispr