ID: 971797469 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:31246553-31246575 |
| Sequence | ACACATAGACTGAAGGTAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 971797466_971797469 | 23 | Left | 971797466 | 4:31246507-31246529 | CCTAACTATATTCTTTCTATAAG | No data | ||
| Right | 971797469 | 4:31246553-31246575 | ACACATAGACTGAAGGTAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 971797469 | Original CRISPR | ACACATAGACTGAAGGTAAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||