ID: 971808994

View in Genome Browser
Species Human (GRCh38)
Location 4:31398996-31399018
Sequence GTGACTTGCTTTTAGCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971808994_971808995 -2 Left 971808994 4:31398996-31399018 CCTACTGGCTAAAAGCAAGTCAC No data
Right 971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG No data
971808994_971808997 0 Left 971808994 4:31398996-31399018 CCTACTGGCTAAAAGCAAGTCAC No data
Right 971808997 4:31399019-31399041 TGAAGACATCCATATTTAAGGGG No data
971808994_971808996 -1 Left 971808994 4:31398996-31399018 CCTACTGGCTAAAAGCAAGTCAC No data
Right 971808996 4:31399018-31399040 CTGAAGACATCCATATTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971808994 Original CRISPR GTGACTTGCTTTTAGCCAGT AGG (reversed) Intergenic
No off target data available for this crispr