ID: 971808995

View in Genome Browser
Species Human (GRCh38)
Location 4:31399017-31399039
Sequence ACTGAAGACATCCATATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971808993_971808995 10 Left 971808993 4:31398984-31399006 CCTTCATCGTATCCTACTGGCTA No data
Right 971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG No data
971808994_971808995 -2 Left 971808994 4:31398996-31399018 CCTACTGGCTAAAAGCAAGTCAC No data
Right 971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971808995 Original CRISPR ACTGAAGACATCCATATTTA AGG Intergenic
No off target data available for this crispr