ID: 971809995

View in Genome Browser
Species Human (GRCh38)
Location 4:31412553-31412575
Sequence CTGAGGGCCTAGAATTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971809994_971809995 -10 Left 971809994 4:31412540-31412562 CCAGTAACGTATTCTGAGGGCCT No data
Right 971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG No data
971809990_971809995 1 Left 971809990 4:31412529-31412551 CCGCACTCAGCCCAGTAACGTAT No data
Right 971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG No data
971809989_971809995 4 Left 971809989 4:31412526-31412548 CCACCGCACTCAGCCCAGTAACG No data
Right 971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG No data
971809993_971809995 -9 Left 971809993 4:31412539-31412561 CCCAGTAACGTATTCTGAGGGCC No data
Right 971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971809995 Original CRISPR CTGAGGGCCTAGAATTGTGC TGG Intergenic
No off target data available for this crispr