ID: 971814107

View in Genome Browser
Species Human (GRCh38)
Location 4:31464941-31464963
Sequence TGGGACTCCTTGGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971814107_971814113 0 Left 971814107 4:31464941-31464963 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 971814113 4:31464964-31464986 GGCTACCAGAAGTTATCTCAGGG No data
971814107_971814115 21 Left 971814107 4:31464941-31464963 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 971814115 4:31464985-31465007 GGCCTTTCATGTTTGCATTAAGG No data
971814107_971814112 -1 Left 971814107 4:31464941-31464963 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 971814112 4:31464963-31464985 AGGCTACCAGAAGTTATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971814107 Original CRISPR TGGGACTCCTTGGAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr