ID: 971817329

View in Genome Browser
Species Human (GRCh38)
Location 4:31505865-31505887
Sequence TTGGGCTGTGACAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971817329_971817346 29 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817346 4:31505917-31505939 CAGGGATGGAGGTTATGCATGGG 0: 83
1: 170
2: 211
3: 234
4: 320
971817329_971817337 -3 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817337 4:31505885-31505907 CAATGGGCCTATGAACAAAGTGG No data
971817329_971817340 10 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817340 4:31505898-31505920 AACAAAGTGGCCATTGTGGCAGG No data
971817329_971817341 11 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817341 4:31505899-31505921 ACAAAGTGGCCATTGTGGCAGGG No data
971817329_971817339 6 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817339 4:31505894-31505916 TATGAACAAAGTGGCCATTGTGG No data
971817329_971817342 15 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817342 4:31505903-31505925 AGTGGCCATTGTGGCAGGGATGG No data
971817329_971817345 28 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817345 4:31505916-31505938 GCAGGGATGGAGGTTATGCATGG 0: 90
1: 181
2: 230
3: 251
4: 427
971817329_971817343 18 Left 971817329 4:31505865-31505887 CCAGCCACCCTGTCACAGCCCAA No data
Right 971817343 4:31505906-31505928 GGCCATTGTGGCAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971817329 Original CRISPR TTGGGCTGTGACAGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr