ID: 971817990

View in Genome Browser
Species Human (GRCh38)
Location 4:31514532-31514554
Sequence TTTTCTTGGTGCAGTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971817990_971817994 17 Left 971817990 4:31514532-31514554 CCTCTTAAACTGCACCAAGAAAA No data
Right 971817994 4:31514572-31514594 AATTGCCTAGCATCCCATTAGGG No data
971817990_971817996 29 Left 971817990 4:31514532-31514554 CCTCTTAAACTGCACCAAGAAAA No data
Right 971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG No data
971817990_971817993 16 Left 971817990 4:31514532-31514554 CCTCTTAAACTGCACCAAGAAAA No data
Right 971817993 4:31514571-31514593 GAATTGCCTAGCATCCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971817990 Original CRISPR TTTTCTTGGTGCAGTTTAAG AGG (reversed) Intergenic
No off target data available for this crispr