ID: 971817992

View in Genome Browser
Species Human (GRCh38)
Location 4:31514546-31514568
Sequence CAGAGCCATTGAGCTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971817992_971817999 29 Left 971817992 4:31514546-31514568 CCAAGAAAAGCTCAATGGCTCTG No data
Right 971817999 4:31514598-31514620 ACTTAAAGGCTGATAGCATAAGG No data
971817992_971817996 15 Left 971817992 4:31514546-31514568 CCAAGAAAAGCTCAATGGCTCTG No data
Right 971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG No data
971817992_971817993 2 Left 971817992 4:31514546-31514568 CCAAGAAAAGCTCAATGGCTCTG No data
Right 971817993 4:31514571-31514593 GAATTGCCTAGCATCCCATTAGG No data
971817992_971817994 3 Left 971817992 4:31514546-31514568 CCAAGAAAAGCTCAATGGCTCTG No data
Right 971817994 4:31514572-31514594 AATTGCCTAGCATCCCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971817992 Original CRISPR CAGAGCCATTGAGCTTTTCT TGG (reversed) Intergenic
No off target data available for this crispr