ID: 971817996

View in Genome Browser
Species Human (GRCh38)
Location 4:31514584-31514606
Sequence TCCCATTAGGGCTCACTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971817990_971817996 29 Left 971817990 4:31514532-31514554 CCTCTTAAACTGCACCAAGAAAA No data
Right 971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG No data
971817992_971817996 15 Left 971817992 4:31514546-31514568 CCAAGAAAAGCTCAATGGCTCTG No data
Right 971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971817996 Original CRISPR TCCCATTAGGGCTCACTTAA AGG Intergenic
No off target data available for this crispr