ID: 971819798

View in Genome Browser
Species Human (GRCh38)
Location 4:31537402-31537424
Sequence ACATAAAAGATACAATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971819798_971819801 5 Left 971819798 4:31537402-31537424 CCACCAAATTGTATCTTTTATGT No data
Right 971819801 4:31537430-31537452 ATTTAGTACATTTATATCCAAGG No data
971819798_971819803 24 Left 971819798 4:31537402-31537424 CCACCAAATTGTATCTTTTATGT No data
Right 971819803 4:31537449-31537471 AAGGTTAATATTAACATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971819798 Original CRISPR ACATAAAAGATACAATTTGG TGG (reversed) Intergenic
No off target data available for this crispr