ID: 971820040

View in Genome Browser
Species Human (GRCh38)
Location 4:31539901-31539923
Sequence CTGTGAGAAAGAATGACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971820040_971820047 14 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820047 4:31539938-31539960 CCCATGTTAGATCCAAGGCTTGG No data
971820040_971820049 15 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820049 4:31539939-31539961 CCATGTTAGATCCAAGGCTTGGG No data
971820040_971820052 27 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data
971820040_971820044 9 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG No data
971820040_971820050 19 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820050 4:31539943-31539965 GTTAGATCCAAGGCTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971820040 Original CRISPR CTGTGAGAAAGAATGACACT GGG (reversed) Intergenic
No off target data available for this crispr