ID: 971820041

View in Genome Browser
Species Human (GRCh38)
Location 4:31539902-31539924
Sequence ACTGTGAGAAAGAATGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971820041_971820044 8 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG No data
971820041_971820050 18 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820050 4:31539943-31539965 GTTAGATCCAAGGCTTGGGATGG No data
971820041_971820049 14 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820049 4:31539939-31539961 CCATGTTAGATCCAAGGCTTGGG No data
971820041_971820047 13 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820047 4:31539938-31539960 CCCATGTTAGATCCAAGGCTTGG No data
971820041_971820052 26 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971820041 Original CRISPR ACTGTGAGAAAGAATGACAC TGG (reversed) Intergenic