ID: 971820044

View in Genome Browser
Species Human (GRCh38)
Location 4:31539933-31539955
Sequence TCCTTCCCATGTTAGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971820041_971820044 8 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG No data
971820040_971820044 9 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971820044 Original CRISPR TCCTTCCCATGTTAGATCCA AGG Intergenic
No off target data available for this crispr