ID: 971820052

View in Genome Browser
Species Human (GRCh38)
Location 4:31539951-31539973
Sequence CAAGGCTTGGGATGGTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971820043_971820052 1 Left 971820043 4:31539927-31539949 CCTGGCTCCTTCCCATGTTAGAT No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data
971820046_971820052 -10 Left 971820046 4:31539938-31539960 CCCATGTTAGATCCAAGGCTTGG No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data
971820045_971820052 -6 Left 971820045 4:31539934-31539956 CCTTCCCATGTTAGATCCAAGGC No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data
971820040_971820052 27 Left 971820040 4:31539901-31539923 CCCAGTGTCATTCTTTCTCACAG No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data
971820041_971820052 26 Left 971820041 4:31539902-31539924 CCAGTGTCATTCTTTCTCACAGT No data
Right 971820052 4:31539951-31539973 CAAGGCTTGGGATGGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971820052 Original CRISPR CAAGGCTTGGGATGGTCAAG AGG Intergenic
No off target data available for this crispr