ID: 971823950

View in Genome Browser
Species Human (GRCh38)
Location 4:31596972-31596994
Sequence TAACCTAGGCTGGTATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971823946_971823950 27 Left 971823946 4:31596922-31596944 CCAAGATGAGAATAGTACTGGGT No data
Right 971823950 4:31596972-31596994 TAACCTAGGCTGGTATAGACAGG No data
971823947_971823950 3 Left 971823947 4:31596946-31596968 CCATGTGAACTCATAAGAAGCAT No data
Right 971823950 4:31596972-31596994 TAACCTAGGCTGGTATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971823950 Original CRISPR TAACCTAGGCTGGTATAGAC AGG Intergenic
No off target data available for this crispr