ID: 971837633

View in Genome Browser
Species Human (GRCh38)
Location 4:31788672-31788694
Sequence TTGGAATGTCCCTCCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971837631_971837633 -9 Left 971837631 4:31788658-31788680 CCTCCTCATTATCTTTGGAATGT No data
Right 971837633 4:31788672-31788694 TTGGAATGTCCCTCCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971837633 Original CRISPR TTGGAATGTCCCTCCTTTTG TGG Intergenic
No off target data available for this crispr