ID: 971854220

View in Genome Browser
Species Human (GRCh38)
Location 4:32023278-32023300
Sequence TAGGTTCTTAAATATGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971854220_971854226 14 Left 971854220 4:32023278-32023300 CCATTCCCATATTTAAGAACCTA No data
Right 971854226 4:32023315-32023337 AGCCATTACAGTTGTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971854220 Original CRISPR TAGGTTCTTAAATATGGGAA TGG (reversed) Intergenic
No off target data available for this crispr