ID: 971854587

View in Genome Browser
Species Human (GRCh38)
Location 4:32026897-32026919
Sequence TACTTGCTTTCTACGATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971854587_971854594 12 Left 971854587 4:32026897-32026919 CCCCTCATCGTAGAAAGCAAGTA No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854587_971854595 13 Left 971854587 4:32026897-32026919 CCCCTCATCGTAGAAAGCAAGTA No data
Right 971854595 4:32026933-32026955 GCCATTTTAACCACCATAATGGG No data
971854587_971854590 -9 Left 971854587 4:32026897-32026919 CCCCTCATCGTAGAAAGCAAGTA No data
Right 971854590 4:32026911-32026933 AAGCAAGTATGTACAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971854587 Original CRISPR TACTTGCTTTCTACGATGAG GGG (reversed) Intergenic
No off target data available for this crispr