ID: 971854589

View in Genome Browser
Species Human (GRCh38)
Location 4:32026899-32026921
Sequence CATACTTGCTTTCTACGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971854589_971854594 10 Left 971854589 4:32026899-32026921 CCTCATCGTAGAAAGCAAGTATG No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854589_971854595 11 Left 971854589 4:32026899-32026921 CCTCATCGTAGAAAGCAAGTATG No data
Right 971854595 4:32026933-32026955 GCCATTTTAACCACCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971854589 Original CRISPR CATACTTGCTTTCTACGATG AGG (reversed) Intergenic
No off target data available for this crispr