ID: 971854594

View in Genome Browser
Species Human (GRCh38)
Location 4:32026932-32026954
Sequence GGCCATTTTAACCACCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971854585_971854594 14 Left 971854585 4:32026895-32026917 CCCCCCTCATCGTAGAAAGCAAG No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854588_971854594 11 Left 971854588 4:32026898-32026920 CCCTCATCGTAGAAAGCAAGTAT No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854586_971854594 13 Left 971854586 4:32026896-32026918 CCCCCTCATCGTAGAAAGCAAGT No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854587_971854594 12 Left 971854587 4:32026897-32026919 CCCCTCATCGTAGAAAGCAAGTA No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854589_971854594 10 Left 971854589 4:32026899-32026921 CCTCATCGTAGAAAGCAAGTATG No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data
971854584_971854594 18 Left 971854584 4:32026891-32026913 CCTGCCCCCCTCATCGTAGAAAG No data
Right 971854594 4:32026932-32026954 GGCCATTTTAACCACCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971854594 Original CRISPR GGCCATTTTAACCACCATAA TGG Intergenic
No off target data available for this crispr