ID: 971856698

View in Genome Browser
Species Human (GRCh38)
Location 4:32053695-32053717
Sequence CAGCCAATGAAAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971856698_971856700 -6 Left 971856698 4:32053695-32053717 CCTGCAGCTGCTTTCATTGGCTG No data
Right 971856700 4:32053712-32053734 TGGCTGGCACTGCACGTATGTGG No data
971856698_971856701 4 Left 971856698 4:32053695-32053717 CCTGCAGCTGCTTTCATTGGCTG No data
Right 971856701 4:32053722-32053744 TGCACGTATGTGGCTTTTCCAGG No data
971856698_971856704 24 Left 971856698 4:32053695-32053717 CCTGCAGCTGCTTTCATTGGCTG No data
Right 971856704 4:32053742-32053764 AGGCACACGGTACAGACTGTAGG No data
971856698_971856702 11 Left 971856698 4:32053695-32053717 CCTGCAGCTGCTTTCATTGGCTG No data
Right 971856702 4:32053729-32053751 ATGTGGCTTTTCCAGGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971856698 Original CRISPR CAGCCAATGAAAGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr