ID: 971857653

View in Genome Browser
Species Human (GRCh38)
Location 4:32062825-32062847
Sequence CAAAGCTCTTGACCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971857653_971857654 15 Left 971857653 4:32062825-32062847 CCAGTAACAGGTCAAGAGCTTTG No data
Right 971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG 0: 21
1: 199
2: 184
3: 120
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971857653 Original CRISPR CAAAGCTCTTGACCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr