ID: 971860568

View in Genome Browser
Species Human (GRCh38)
Location 4:32097824-32097846
Sequence ATGTGTAAGCAAAAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971860568_971860572 -1 Left 971860568 4:32097824-32097846 CCTATTTCCTTTTGCTTACACAT No data
Right 971860572 4:32097846-32097868 TATTTTGAAATTGATATGTGGGG No data
971860568_971860571 -2 Left 971860568 4:32097824-32097846 CCTATTTCCTTTTGCTTACACAT No data
Right 971860571 4:32097845-32097867 ATATTTTGAAATTGATATGTGGG No data
971860568_971860570 -3 Left 971860568 4:32097824-32097846 CCTATTTCCTTTTGCTTACACAT No data
Right 971860570 4:32097844-32097866 CATATTTTGAAATTGATATGTGG No data
971860568_971860573 0 Left 971860568 4:32097824-32097846 CCTATTTCCTTTTGCTTACACAT No data
Right 971860573 4:32097847-32097869 ATTTTGAAATTGATATGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971860568 Original CRISPR ATGTGTAAGCAAAAGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr