ID: 971864786

View in Genome Browser
Species Human (GRCh38)
Location 4:32155504-32155526
Sequence TCTTCAACACAGAACTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971864781_971864786 26 Left 971864781 4:32155455-32155477 CCTCACCATATAAGTTTAATTGC No data
Right 971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG No data
971864783_971864786 4 Left 971864783 4:32155477-32155499 CCTAGTTTAAGCTCCTACCGTCT No data
Right 971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG No data
971864782_971864786 21 Left 971864782 4:32155460-32155482 CCATATAAGTTTAATTGCCTAGT No data
Right 971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG No data
971864784_971864786 -9 Left 971864784 4:32155490-32155512 CCTACCGTCTTTCATCTTCAACA No data
Right 971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971864786 Original CRISPR TCTTCAACACAGAACTATCT TGG Intergenic
No off target data available for this crispr