ID: 971871840

View in Genome Browser
Species Human (GRCh38)
Location 4:32251018-32251040
Sequence CAGTGGCAAGGTAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971871840_971871845 8 Left 971871840 4:32251018-32251040 CCCAGCTAATTACCTTGCCACTG No data
Right 971871845 4:32251049-32251071 TTTAGATATTACTTTATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971871840 Original CRISPR CAGTGGCAAGGTAATTAGCT GGG (reversed) Intergenic
No off target data available for this crispr