ID: 971881401

View in Genome Browser
Species Human (GRCh38)
Location 4:32379260-32379282
Sequence GTGTTTTACCAGATCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971881399_971881401 26 Left 971881399 4:32379211-32379233 CCTTCATTGAAATCTGTAGCTTG No data
Right 971881401 4:32379260-32379282 GTGTTTTACCAGATCCCAGGTGG No data
971881398_971881401 29 Left 971881398 4:32379208-32379230 CCTCCTTCATTGAAATCTGTAGC No data
Right 971881401 4:32379260-32379282 GTGTTTTACCAGATCCCAGGTGG No data
971881397_971881401 30 Left 971881397 4:32379207-32379229 CCCTCCTTCATTGAAATCTGTAG No data
Right 971881401 4:32379260-32379282 GTGTTTTACCAGATCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971881401 Original CRISPR GTGTTTTACCAGATCCCAGG TGG Intergenic
No off target data available for this crispr