ID: 971884927

View in Genome Browser
Species Human (GRCh38)
Location 4:32432232-32432254
Sequence GGTCACAACATTCCAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971884927_971884937 16 Left 971884927 4:32432232-32432254 CCACCCCTTGGAATGTTGTGACC No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data
971884927_971884935 7 Left 971884927 4:32432232-32432254 CCACCCCTTGGAATGTTGTGACC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971884927 Original CRISPR GGTCACAACATTCCAAGGGG TGG (reversed) Intergenic
No off target data available for this crispr