ID: 971884935

View in Genome Browser
Species Human (GRCh38)
Location 4:32432262-32432284
Sequence CAGGAACACCTCAGCCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971884929_971884935 3 Left 971884929 4:32432236-32432258 CCCTTGGAATGTTGTGACCAGCG No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884927_971884935 7 Left 971884927 4:32432232-32432254 CCACCCCTTGGAATGTTGTGACC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884928_971884935 4 Left 971884928 4:32432235-32432257 CCCCTTGGAATGTTGTGACCAGC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884930_971884935 2 Left 971884930 4:32432237-32432259 CCTTGGAATGTTGTGACCAGCGG No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884923_971884935 28 Left 971884923 4:32432211-32432233 CCACCCTATGAAGTGCTGGCACC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884924_971884935 25 Left 971884924 4:32432214-32432236 CCCTATGAAGTGCTGGCACCACC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data
971884925_971884935 24 Left 971884925 4:32432215-32432237 CCTATGAAGTGCTGGCACCACCC No data
Right 971884935 4:32432262-32432284 CAGGAACACCTCAGCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971884935 Original CRISPR CAGGAACACCTCAGCCATAC TGG Intergenic
No off target data available for this crispr