ID: 971884937

View in Genome Browser
Species Human (GRCh38)
Location 4:32432271-32432293
Sequence CTCAGCCATACTGGTGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971884930_971884937 11 Left 971884930 4:32432237-32432259 CCTTGGAATGTTGTGACCAGCGG No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data
971884929_971884937 12 Left 971884929 4:32432236-32432258 CCCTTGGAATGTTGTGACCAGCG No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data
971884928_971884937 13 Left 971884928 4:32432235-32432257 CCCCTTGGAATGTTGTGACCAGC No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data
971884927_971884937 16 Left 971884927 4:32432232-32432254 CCACCCCTTGGAATGTTGTGACC No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data
971884933_971884937 -5 Left 971884933 4:32432253-32432275 CCAGCGGTCCAGGAACACCTCAG No data
Right 971884937 4:32432271-32432293 CTCAGCCATACTGGTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971884937 Original CRISPR CTCAGCCATACTGGTGCAGT AGG Intergenic
No off target data available for this crispr