ID: 971886205

View in Genome Browser
Species Human (GRCh38)
Location 4:32451562-32451584
Sequence TTTGTCTTGTCACCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971886205_971886206 -8 Left 971886205 4:32451562-32451584 CCAGTCTTTGGTGACAAGACAAA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886205_971886208 14 Left 971886205 4:32451562-32451584 CCAGTCTTTGGTGACAAGACAAA No data
Right 971886208 4:32451599-32451621 GTATCAATAACCTTACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971886205 Original CRISPR TTTGTCTTGTCACCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr