ID: 971886206

View in Genome Browser
Species Human (GRCh38)
Location 4:32451577-32451599
Sequence AAGACAAACCAAGCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971886200_971886206 11 Left 971886200 4:32451543-32451565 CCCTACTCAAATCCTCGTCCCAG No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886201_971886206 10 Left 971886201 4:32451544-32451566 CCTACTCAAATCCTCGTCCCAGT No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886204_971886206 -7 Left 971886204 4:32451561-32451583 CCCAGTCTTTGGTGACAAGACAA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886203_971886206 -1 Left 971886203 4:32451555-32451577 CCTCGTCCCAGTCTTTGGTGACA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886205_971886206 -8 Left 971886205 4:32451562-32451584 CCAGTCTTTGGTGACAAGACAAA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886198_971886206 25 Left 971886198 4:32451529-32451551 CCCAAATAAGTTATCCCTACTCA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data
971886199_971886206 24 Left 971886199 4:32451530-32451552 CCAAATAAGTTATCCCTACTCAA No data
Right 971886206 4:32451577-32451599 AAGACAAACCAAGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971886206 Original CRISPR AAGACAAACCAAGCAAAAAG AGG Intergenic
No off target data available for this crispr