ID: 971886208

View in Genome Browser
Species Human (GRCh38)
Location 4:32451599-32451621
Sequence GTATCAATAACCTTACATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971886205_971886208 14 Left 971886205 4:32451562-32451584 CCAGTCTTTGGTGACAAGACAAA No data
Right 971886208 4:32451599-32451621 GTATCAATAACCTTACATCTAGG No data
971886204_971886208 15 Left 971886204 4:32451561-32451583 CCCAGTCTTTGGTGACAAGACAA No data
Right 971886208 4:32451599-32451621 GTATCAATAACCTTACATCTAGG No data
971886207_971886208 -9 Left 971886207 4:32451585-32451607 CCAAGCAAAAAGAGGTATCAATA No data
Right 971886208 4:32451599-32451621 GTATCAATAACCTTACATCTAGG No data
971886203_971886208 21 Left 971886203 4:32451555-32451577 CCTCGTCCCAGTCTTTGGTGACA No data
Right 971886208 4:32451599-32451621 GTATCAATAACCTTACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971886208 Original CRISPR GTATCAATAACCTTACATCT AGG Intergenic
No off target data available for this crispr