ID: 971887210

View in Genome Browser
Species Human (GRCh38)
Location 4:32466130-32466152
Sequence AGCCATTAAAATAATAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971887210_971887212 8 Left 971887210 4:32466130-32466152 CCTACCTTATTATTTTAATGGCT No data
Right 971887212 4:32466161-32466183 TGCAGCGTTAGCAGCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971887210 Original CRISPR AGCCATTAAAATAATAAGGT AGG (reversed) Intergenic
No off target data available for this crispr