ID: 971888026

View in Genome Browser
Species Human (GRCh38)
Location 4:32478217-32478239
Sequence CTCAAATATTTTTAGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971888026_971888030 30 Left 971888026 4:32478217-32478239 CCATCTATCTAAAAATATTTGAG No data
Right 971888030 4:32478270-32478292 TGTAGTTGAGGCTATTTTAGAGG No data
971888026_971888029 18 Left 971888026 4:32478217-32478239 CCATCTATCTAAAAATATTTGAG No data
Right 971888029 4:32478258-32478280 CCTCAAATAAAATGTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971888026 Original CRISPR CTCAAATATTTTTAGATAGA TGG (reversed) Intergenic
No off target data available for this crispr