ID: 971891903

View in Genome Browser
Species Human (GRCh38)
Location 4:32535075-32535097
Sequence GTGGAGGACTGGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971891898_971891903 -8 Left 971891898 4:32535060-32535082 CCTATGGGAAAAGTAGTGGAGGA No data
Right 971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971891903 Original CRISPR GTGGAGGACTGGAGGGAAGG TGG Intergenic
No off target data available for this crispr