ID: 971892475

View in Genome Browser
Species Human (GRCh38)
Location 4:32543249-32543271
Sequence TCATCCCCACATGTAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971892468_971892475 27 Left 971892468 4:32543199-32543221 CCCTTATATATGTTGGCGCTGTG No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892474_971892475 -3 Left 971892474 4:32543229-32543251 CCAAATCACATTTGGAATTGTCA No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892469_971892475 26 Left 971892469 4:32543200-32543222 CCTTATATATGTTGGCGCTGTGT No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892473_971892475 -2 Left 971892473 4:32543228-32543250 CCCAAATCACATTTGGAATTGTC No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892467_971892475 28 Left 971892467 4:32543198-32543220 CCCCTTATATATGTTGGCGCTGT No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892471_971892475 2 Left 971892471 4:32543224-32543246 CCCACCCAAATCACATTTGGAAT No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data
971892472_971892475 1 Left 971892472 4:32543225-32543247 CCACCCAAATCACATTTGGAATT No data
Right 971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971892475 Original CRISPR TCATCCCCACATGTAGAGAG AGG Intergenic
No off target data available for this crispr