ID: 971906011

View in Genome Browser
Species Human (GRCh38)
Location 4:32726912-32726934
Sequence CACAATCTCCAATCGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971906011_971906017 -4 Left 971906011 4:32726912-32726934 CCCTGCTCCGATTGGAGATTGTG No data
Right 971906017 4:32726931-32726953 TGTGGGCATAGACAAAGTGGAGG No data
971906011_971906018 0 Left 971906011 4:32726912-32726934 CCCTGCTCCGATTGGAGATTGTG No data
Right 971906018 4:32726935-32726957 GGCATAGACAAAGTGGAGGCAGG No data
971906011_971906016 -7 Left 971906011 4:32726912-32726934 CCCTGCTCCGATTGGAGATTGTG No data
Right 971906016 4:32726928-32726950 GATTGTGGGCATAGACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971906011 Original CRISPR CACAATCTCCAATCGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr